Agrilus otiosus

Say, 1833 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records43

Data sources7

Biological traits0

DNA specimens9

eDNA detections0

Sources7 archives

Databases and archives Agrilus otiosus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility43 records↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF43 records

DNA & barcodingBOLD9 specimens

01Narrative

Agrilus otiosus, the hickory agrilus, is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus otiosus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.34%

Haplotypes1

BIN1

Where individuals differ — all 4 variable positions, in barcode order

40Amostly conserved

64Tmostly conserved

409Gmostly conserved

433Avariable

AACACTTTACTTTATCTTTGGAGCCTGATCAGGAATGGTAGGAACAGCATTAAGGCTCCTAATTCGTGCTGAACTAGGAAACCCCGGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus osburnisame genus3.8%Agrilus cephalicussame genus13.1%Agrilus moerenssame genus16.4%Agrilus masculinussame genus16.5%Agrilus sibiricussame genus17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type43 records

Wild obs. + sensor3

Museum / vouchered40

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤1 km 1≤10 km 10>10 km 1

12 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Agency of Natural Resources Department of Forests, Parks and Recreationlocation not on record	7
SOVTlocation not on record	6
St. Paul, US	5
University Park, US	5
University of Guelphlocation not on record	4
Espace pour la vielocation not on record	2
Lexington, US	2
CUlocation not on record	1
Denver, US	1
College Station, US	1
Washington, US	1
ASUlocation not on record	1
US	1

13 institutions · 37 of 40 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)