Agrilus moerens

Saunders, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records29

Data sources7

Biological traits0

DNA specimens5

eDNA detections4

Sources7 archives

Databases and archives Agrilus moerens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF29 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD5 specimens

01Narrative

Agrilus moerens é uma espécie de inseto do género Agrilus, família Buprestidae, ordem Coleoptera. Foi descrita cientificamente por Saunders, 1873.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus moerens has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P620 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 48 variable positions, in barcode order

37Tmostly conserved

39Gmostly conserved

66Gmostly conserved

69Gmostly conserved

87Cmostly conserved

96Tmostly conserved

108Tmostly conserved

126Amostly conserved

138Tmostly conserved

165Amostly conserved

177Amostly conserved

178Tmostly conserved

180Amostly conserved

193Cmostly conserved

204Cmostly conserved

207Cmostly conserved

213Amostly conserved

255Cvariable

258Amostly conserved

261Amostly conserved

306Cmostly conserved

312Amostly conserved

324Avariable

345Cmostly conserved

348Cvariable

354Cmostly conserved

393Cmostly conserved

417Amostly conserved

441Tmostly conserved

444Tmostly conserved

447Amostly conserved

465Cmostly conserved

484Cmostly conserved

489Tmostly conserved

504Tvariable

522Gmostly conserved

523Cmostly conserved

537Cmostly conserved

558Gmostly conserved

561Amostly conserved

564Gmostly conserved

582Cvariable

585Cmostly conserved

588Tmostly conserved

601Gmostly conserved

603Tmostly conserved

615Cmostly conserved

618Amostly conserved

GGGGCCTGATCAGGAATAGTAGGAACAGCACTAAGATTGTTAATTCGTGCTGAACTAGGTAACCCGGGGGCCTTAATTGGAAATGACCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.4%

Haplotypes3

BINs2

Most divergent pair7.3%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus sibiricussame genus13.7%Agrilus masculinussame genus14.2%Germarica lilliputanasame family15.2%Agrilus adelphinussame genus15.3%Agrilus ribbeisame genus15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type29 records

Wild obs. + sensor12

Museum / vouchered17

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1>10 km 3

4 georeferenced · 8 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kushiro City Museumlocation not on record	7
Chiba, JP	4
Zoological Museum, University of Amoylocation not on record	1
Zoological Institute, Russian Academy of Scienceslocation not on record	1
Nagatoro-machi, Chichibu-gun, JP	1
EJCBlocation not on record	1

6 institutions · 15 of 17 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Agrilus moerens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 15.0–15.0

Seasonal swing summer↔winter33.6 °C

Max temp (day)17.8 °C

Min temp (night)12.6 °C

Precipitation87.6 mm/mo

Air humidity66.6 %

Moisture balance-26.3 mm/mo

Vapour deficit571 Pa

Wind speed2.40 m/s

Cloud cover50.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)