Agrilus ribbei

Kiesenwetter, 1879 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records96

Data sources6

Biological traits0

DNA specimens33

eDNA detections61

Sources6 archives

Databases and archives Agrilus ribbei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility96 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI61 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF96 records

Environmental DNA1 datasets · 2 countries61 detections

DNA & barcodingBOLD33 specimens

01Narrative

Agrilus ribbei é uma espécie de inseto do género Agrilus, família Buprestidae, ordem Coleoptera. Foi descrita cientificamente por Kiesenwetter in Kraatz & Kiesenwetter, 1879.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus ribbei has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes2

eDNA detections61

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

31Amostly conserved

34Amostly conserved

313Amostly conserved

376Gmostly conserved

628Gmostly conserved

630Gmostly conserved

631Gmostly conserved

633Amostly conserved

640Tmostly conserved

641Cmostly conserved

AACACTTTATTTTATTTTTGGGGCCTGATCAGGAATAGTAGGAACTGCTTTGAGTCTTTTGGTCCGAGCAGAGCTAGGAAACCCTGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes7

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus laticornissame genus12.0%Agrilus ussuricolasame genus12.0%Agrilus graminissame genus12.6%Agrilus hastulifersame genus13.3%Agrilus lacroixisame genus14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type96 records

Wild obs. + sensor9

Museum / vouchered87

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 1≤1 km 2>10 km 5

8 georeferenced · 1 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 8

8 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence87

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kushiro City Museumlocation not on record	33
EJCBlocation not on record	7
National Academy of Sciences of Armenialocation not on record	4
Muzeum Górnośląskie w Bytomiulocation not on record	4
MKCYlocation not on record	3
Paris, FR	2
NMPClocation not on record	2
Zoological Institute, Russian Academy of Scienceslocation not on record	1
BUJClocation not on record	1
RAPClocation not on record	1
Canadian Food Inspection Agency / Genotyping/Botanylocation not on record	1

11 institutions · 59 of 87 vouchered records shown · 27 without an institution code

09Environmental DNA61 detections

Where the DNA of Agrilus ribbei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found61

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 61 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 13.7–17.2

Seasonal swing summer↔winter33.6 °C

Max temp (day)18.1 °C 17.8–19.6

Min temp (night)10.5 °C 9.60–15.2

Precipitation98.7 mm/mo 64.6–125

Air humidity63.2 % 62.9–70.7

Moisture balance-2.00 mm/mo -54.2–26.6

Vapour deficit578 Pa 571–632

Wind speed2.40 m/s 2.00–4.20

Cloud cover47.0 % 46.3–50.7

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)