Agrilus graminis

Kiesenwetter, 1857 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records776

Data sources7

Biological traits0

DNA specimens27

eDNA detections28

Sources7 archives

Databases and archives Agrilus graminis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility776 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF776 records

Environmental DNA1 datasets · 10 countries28 detections

DNA & barcodingBOLD27 specimens

01Narrative

Agrilus graminis é uma espécie de insetos coleópteros polífagos pertencente à família Buprestidae. A autoridade científica da espécie é Gory & Laporte, tendo sido descrita no ano de 1837. Trata-se de uma espécie presente no território português.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus graminis has left across the world's sequence archives.

At a glance

DNA specimens27

BINs3

Marker genes2

eDNA detections28

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

1Gmostly conserved

34Cmostly conserved

50Tvariable

73Amostly conserved

88Gmostly conserved

91Tvariable

112Cmostly conserved

166Amostly conserved

190Avariable

196Avariable

217Tvariable

241Gmostly conserved

319Tmostly conserved

343Amostly conserved

349Gvariable

364Cvariable

526Avariable

547Avariable

586Tmostly conserved

607Cmostly conserved

GACACTTTATTTTATTTTTGGGGCCTGATCAGGCATGGTAGGAACTGCTTTAAGTCTCTTAGTGCGAGCAGAACTAGGAAACCCAGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes14

BINs3

Most divergent pair4.9%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus hastulifersame genus11.9%Agrilus ussuricolasame genus12.0%Agrilus laticornissame genus12.5%Agrilus ribbeisame genus12.6%Agrilus adelphinussame genus12.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type776 records

Wild obs. + sensor213

Museum / vouchered377

Other186

Origin

Native107

Range

Area of Occupancy AOO1 296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy28% within 1 km

≤100 m 28≤1 km 21≤10 km 127

176 georeferenced · 37 without coordinates

Open the mapobservation + sensor213

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤1 km 1≤10 km 201

202 georeferenced · 175 without coordinates

Open the institutions mapphysical evidence377

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum Górnośląskie w Bytomiulocation not on record	81
EJCBlocation not on record	65
Geneva, CH	20
Bern, CH	11
Vitoria, ES	10
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	7
Musee d'Histoire Naturallelocation not on record	6
Paris, FR	6
MKCYlocation not on record	4
Zürich, CH	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Russian Academy of Sciences, Zoological Institute, Zoological Museumlocation not on record	2
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	2
Dhaka, BD	2
ZSMlocation not on record	1
Department of Molecular Biodiversity, Institute of Systematics and Evolution of Animals of the Polish Academy of Scienceslocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
MZLUlocation not on record	1
Bundesforschungs- und Ausbildungszentrum fur Waldlocation not on record	1

19 institutions · 225 of 377 vouchered records shown · 151 without an institution code

09Environmental DNA28 detections

Where the DNA of Agrilus graminis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map10 countries0

LaubwaldForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 5.90–20.2

Seasonal swing summer↔winter20.1 °C

Max temp (day)21.2 °C 9.70–24.4

Min temp (night)11.9 °C 1.10–14.6

Precipitation75.2 mm/mo 45.9–120

Air humidity59.6 % 55.4–65.9

Moisture balance-26.4 mm/mo -107–28.8

Vapour deficit814 Pa 370–1,001

Wind speed2.80 m/s 1.80–3.60

Cloud cover37.7 % 32.8–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)