Agrilus hastulifer

(Ratzeburg, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records691

Data sources7

Biological traits0

DNA specimens7

eDNA detections8

Sources7 archives

Databases and archives Agrilus hastulifer's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility691 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF691 records

Environmental DNA1 datasets · 3 countries8 detections

DNA & barcodingBOLD7 specimens

01Narrative

Agrilus hastulifer é uma espécie de insetos coleópteros polífagos pertencente à família Buprestidae. A autoridade científica da espécie é Ratzeburg, tendo sido descrita no ano de 1837. Trata-se de uma espécie presente no território português.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus hastulifer has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes2

eDNA detections8

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)2.9%

Haplotypes2

BINs2

Most divergent pair0.61%

Where individuals differ — all 30 variable positions, in barcode order

51Gvariable

64Cvariable

81Avariable

114Avariable

120Cvariable

132Cvariable

138Cvariable

186Cvariable

226Cvariable

231Tmostly conserved

264Cmostly conserved

285Avariable

297Cvariable

318Avariable

321Amostly conserved

339Amostly conserved

348Avariable

378Tmostly conserved

387Avariable

390Cvariable

402Avariable

404Cmostly conserved

429Avariable

477Cvariable

493Amostly conserved

546Avariable

552Amostly conserved

592Cvariable

633Avariable

636Tvariable

CATAAAGACATTGGAACACTTTATTTTATTTTTGGGGCCTGATCAGGCATGGTGGGAACTGCTCTAAGTCTTTTAGTTCGAGCAGAATTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus graminissame genus11.9%Agrilus laticornissame genus12.9%Agrilus ussuricolasame genus13.2%Agrilus ribbeisame genus13.3%Agrilus olivicolorsame genus13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type691 records

Wild obs. + sensor303

Museum / vouchered111

Other277

Origin

Native8

Range

Area of Occupancy AOO944 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy21% within 1 km

≤100 m 33≤1 km 21≤10 km 203>10 km 3

260 georeferenced · 43 without coordinates

Open the mapobservation + sensor303

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤1 km 12≤10 km 51>10 km 1

64 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence111

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vitoria, ES	35
Muzeum Górnośląskie w Bytomiulocation not on record	28
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	8
MZLUlocation not on record	4
Provincia di Livornolocation not on record	4
Adam Mickiewicz University in Poznańlocation not on record	2
JKSlocation not on record	2
Natural History Museum Rotterdamlocation not on record	1
Paris, FR	1
EJCBlocation not on record	1
ZSMlocation not on record	1

11 institutions · 87 of 111 vouchered records shown · 21 without an institution code

09Environmental DNA8 detections

Where the DNA of Agrilus hastulifer was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.90 °C 5.90–22.4

Seasonal swing summer↔winter20.5 °C

Max temp (day)9.70 °C 9.70–26.3

Min temp (night)1.10 °C 1.10–17.6

Precipitation82.6 mm/mo 63.7–92.3

Air humidity65.9 % 55.9–65.9

Moisture balance28.8 mm/mo -68.1–28.8

Vapour deficit370 Pa 370–1,201

Wind speed1.80 m/s 1.80–3.70

Cloud cover43.4 % 35.2–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)