Agrilus cephalicus

LeConte, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records151

Data sources8

Biological traits0

DNA specimens9

eDNA detections9

Sources8 archives

Databases and archives Agrilus cephalicus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility151 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF151 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Agrilus cephalicus, known generally as the dogwood agrilus or dogwood cambium borer, is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus cephalicus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P628 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 98 variable positions, in barcode order

1Amostly conserved

10Cmostly conserved

16Cmostly conserved

22Gmostly conserved

34Amostly conserved

50Cmostly conserved

56Cmostly conserved

61Amostly conserved

64Tmostly conserved

67Tmostly conserved

70Tmostly conserved

73Amostly conserved

85Cmostly conserved

91Tmostly conserved

92Tmostly conserved

106Cmostly conserved

142Tmostly conserved

157Tmostly conserved

163Amostly conserved

169Cmostly conserved

181Amostly conserved

196Amostly conserved

199Gmostly conserved

206Cmostly conserved

212Tmostly conserved

214Amostly conserved

217Amostly conserved

223Amostly conserved

232Cmostly conserved

238Cmostly conserved

241Tmostly conserved

247Cmostly conserved

250Cmostly conserved

262Amostly conserved

268Cmostly conserved

271Tmostly conserved

277Cmostly conserved

282Tmostly conserved

286Gmostly conserved

287Cmostly conserved

294Cmostly conserved

307Amostly conserved

313Amostly conserved

319Gvariable

325Tmostly conserved

328Amostly conserved

337Cmostly conserved

340Cmostly conserved

343Amostly conserved

347Cmostly conserved

349Gmostly conserved

358Tmostly conserved

364Cmostly conserved

373Amostly conserved

379Tmostly conserved

385Cmostly conserved

386Cmostly conserved

391Tmostly conserved

397Cmostly conserved

400Cmostly conserved

415Gvariable

421Amostly conserved

427Tmostly conserved

442Cmostly conserved

451Cmostly conserved

460Cmostly conserved

463Cmostly conserved

475Gvariable

478Cmostly conserved

482Tmostly conserved

484Amostly conserved

485Cmostly conserved

487Tmostly conserved

495Tmostly conserved

496Cmostly conserved

500Cvariable

502Gmostly conserved

505Tmostly conserved

508Amostly conserved

511Gmostly conserved

517Cmostly conserved

535Gmostly conserved

544Gmostly conserved

547Amostly conserved

548Cmostly conserved

550Cmostly conserved

553Tmostly conserved

557Cmostly conserved

559Amostly conserved

562Tmostly conserved

568Tmostly conserved

574Tmostly conserved

583Tmostly conserved

589Cmostly conserved

604Cvariable

619Tvariable

622Tvariable

628Tvariable

AACCCTTTACTTTATCTTTGGGGCCTGATCAGGAATAGTAGGAACAGCACTGAGACTATTAATTCGTGCTGAATTAGGAAACCCCGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.9%

Haplotypes3

BIN1

Most divergent pair15.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus osburnisame genus12.7%Agrilus otiosussame genus13.1%Agrilus masculinussame genus13.7%Pachyschelus nicolayisame family17.0%Pachyschelus laevigatussame family17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type151 records

Wild obs. + sensor3

Museum / vouchered148

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 1>10 km 1

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2>10 km 1

3 georeferenced · 145 without coordinates

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	108
University of Guelphlocation not on record	23
College Station, US	7
WIlocation not on record	3
University Park, US	2
Mississippi State, US	1
CUlocation not on record	1
Cambridge, US	1
Royal Saskatchewan Museumlocation not on record	1

9 institutions · 147 of 148 vouchered records shown · 1 without an institution code

09Environmental DNA9 detections

Where the DNA of Agrilus cephalicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

ForestTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 18.0–22.4

Seasonal swing summer↔winter26.1 °C

Max temp (day)23.9 °C 23.0–27.6

Min temp (night)13.6 °C 13.5–18.2

Precipitation84.5 mm/mo 84.3–131

Air humidity57.1 % 56.6–58.4

Moisture balance-61.6 mm/mo -65.5–-48.4

Vapour deficit914 Pa 857–1,136

Wind speed3.70 m/s 2.80–4.50

Cloud cover42.5 % 36.8–42.8

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)