Agrilus osburni

Knull, 1936 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records27

Data sources8

Biological traits0

DNA specimens8

eDNA detections5

Sources8 archives

Databases and archives Agrilus osburni's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF27 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD8 specimens

01Narrative

Agrilus osburni is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus osburni has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes2

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)2.7%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 27 variable positions, in barcode order

40Gvariable

58Tvariable

85Cvariable

97Cvariable

115Tvariable

130Cvariable

136Tvariable

184Gvariable

202Gvariable

206Tvariable

214Cvariable

232Cvariable

238Cvariable

298Gvariable

310Avariable

343Gvariable

364Cvariable

373Gvariable

433Gvariable

496Tvariable

508Avariable

535Gvariable

562Cvariable

565Gvariable

577Gvariable

592Gvariable

622Tvariable

AACACTTTACTTTATCTTTGGAGCCTGATCAGGAATGGTGGGAACAGCATTAAGACTTCTAATTCGTGCTGAACTAGGAAATCCCGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus otiosussame genus3.8%Agrilus cephalicussame genus12.7%Agrilus masculinussame genus15.8%Agrilus moerenssame genus16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type27 records

Wild obs. + sensor1

Museum / vouchered26

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SOVTlocation not on record	12
Agency of Natural Resources Department of Forests, Parks and Recreationlocation not on record	8
ASUlocation not on record	2
Chicago, US	1

4 institutions · 23 of 26 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Agrilus osburni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C -2.00–16.8

Seasonal swing summer↔winter34.7 °C

Max temp (day)10.9 °C 1.30–20.5

Min temp (night)4.70 °C -4.20–13.6

Precipitation65.9 mm/mo 56.4–75.3

Air humidity62.0 % 59.4–64.5

Moisture balance-38.8 mm/mo -68.4–-9.20

Vapour deficit591 Pa 334–849

Wind speed4.70 m/s 3.90–5.40

Cloud cover49.5 % 43.1–55.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)