Agrilus integerrimus

(Ratzeburg, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records509

Data sources8

Biological traits0

DNA specimens7

eDNA detections7

Sources8 archives

Databases and archives Agrilus integerrimus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility509 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF509 records

Environmental DNA1 datasets · 4 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Agrilus integerrimus is a species of beetles belonging to the family Buprestidae. It is present in most of Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus integerrimus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs3

Marker genes2

eDNA detections7

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P613 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 79% of positions are identical in every specimen.

Where individuals differ — all 131 variable positions, in barcode order

1Avariable

4Avariable

5Cvariable

7Tvariable

10Tmostly conserved

14Cmostly conserved

22Gvariable

25Tmostly conserved

28Avariable

34Tmostly conserved

37Amostly conserved

40Amostly conserved

43Cvariable

46Amostly conserved

52Tmostly conserved

55Avariable

56Cmostly conserved

58Cmostly conserved

59Tmostly conserved

64Tmostly conserved

67Tmostly conserved

76Avariable

82Tmostly conserved

88Gvariable

91Avariable

100Amostly conserved

106Tmostly conserved

109Amostly conserved

115Tvariable

118Tmostly conserved

121Tmostly conserved

124Tmostly conserved

133Cmostly conserved

154Tmostly conserved

157Cmostly conserved

160Avariable

163Amostly conserved

166Gmostly conserved

181Amostly conserved

184Avariable

187Tmostly conserved

190Tvariable

193Tmostly conserved

196Avariable

202Tvariable

205Tmostly conserved

211Amostly conserved

217Avariable

226Cvariable

229Amostly conserved

232Tmostly conserved

247Tmostly conserved

250Cvariable

262Avariable

267Tmostly conserved

271Cmostly conserved

277Cmostly conserved

278Cmostly conserved

280Tvariable

284Cmostly conserved

286Tmostly conserved

295Tmostly conserved

298Amostly conserved

302Gmostly conserved

303Cmostly conserved

304Tmostly conserved

307Gmostly conserved

316Gvariable

322Gvariable

325Amostly conserved

328Tvariable

350Tmostly conserved

352Tmostly conserved

355Tmostly conserved

364Tvariable

371Gmostly conserved

373Amostly conserved

376Gmostly conserved

386Cmostly conserved

388Tvariable

391Tmostly conserved

394Tmostly conserved

401Tmostly conserved

406Cmostly conserved

412Avariable

418Cmostly conserved

424Amostly conserved

425Amostly conserved

436Tmostly conserved

451Tmostly conserved

454Tmostly conserved

457Gvariable

463Cvariable

466Avariable

469Gmostly conserved

472Tmostly conserved

475Tmostly conserved

479Amostly conserved

493Avariable

496Tmostly conserved

499Cmostly conserved

505Tvariable

508Cvariable

511Amostly conserved

514Tmostly conserved

517Cvariable

519Cmostly conserved

532Cvariable

536Tmostly conserved

538Amostly conserved

542Cmostly conserved

544Cmostly conserved

547Amostly conserved

550Avariable

559Avariable

562Amostly conserved

565Tvariable

568Amostly conserved

574Amostly conserved

577Amostly conserved

+11 more variable positions not shown

AACACTTTATTTTCTTTTTGGGGCTTGATCAGGTATAGTAGGCACAGCTCTTAGACTCTTAATTCGTGCAGAACTAGGAAATCCTGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)9.0%

Haplotypes3

BINs3

Most divergent pair17.9%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus pseudocorylisame genus14.4%Agrilus politussame genus14.5%Agrilus viridissame genus14.8%Agrilus suvorovisame genus15.0%Agrilus paludicolasame genus15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type509 records

Wild obs. + sensor137

Museum / vouchered298

Other74

Origin

Native111

Range

Area of Occupancy AOO1 092 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 28≤1 km 11≤10 km 81>10 km 4

124 georeferenced · 13 without coordinates

Open the mapobservation + sensor137

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤1 km 40≤10 km 224>10 km 6

270 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence298

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	31
Musee d'Histoire Naturallelocation not on record	22
Salzburg, AT	16
Bern, CH	15
Brussels, BE	14
Zürich, CH	13
Fribourg, CH	11
Paro, BT	9
Geneva, CH	8
Tallinn, EE	7
Dhaka, BD	6
RBINS-Scientific Heritagelocation not on record	6
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	6
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	5
Frauenfeld, CH	4
Natural History Museum Rotterdamlocation not on record	3
Musée de l'Hospice du Grand-Saint-Bernardlocation not on record	2
Naturmuseum St. Gallenlocation not on record	2
Tartu, EE	2
IFR-DNFlocation not on record	2
Helsinki, FI	2
Muzeum Górnośląskie w Bytomiulocation not on record	2
Oulu, FI	1
Adam Mickiewicz University in Poznańlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
ZSMlocation not on record	1

26 institutions · 192 of 298 vouchered records shown · 105 without an institution code

09Environmental DNA7 detections

Where the DNA of Agrilus integerrimus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map4 countries0

in einer moorigen Bachaue aus der Vegetation…Teichufer

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 9.10–17.0

Seasonal swing summer↔winter20.8 °C

Max temp (day)17.6 °C 13.4–21.2

Min temp (night)6.40 °C 3.70–12.6

Precipitation123 mm/mo 72.0–153

Air humidity63.6 % 59.8–65.5

Moisture balance30.7 mm/mo -28.2–34.6

Vapour deficit542 Pa 436–783

Wind speed1.80 m/s 1.70–2.60

Cloud cover36.6 % 34.8–40.3

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)