Agrilus derasofasciatus

Lacordaire, 1835 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records1 199

Data sources7

Biological traits0

DNA specimens18

eDNA detections16

Sources7 archives

Databases and archives Agrilus derasofasciatus's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 199 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 199 records

Environmental DNA1 datasets · 6 countries16 detections

DNA & barcodingBOLD18 specimens

01Narrative

Agrilus derasofasciatus, the vine jewel beetle, is a species of metallic wood-boring beetle in the family Buprestidae. It is found in Africa, Europe and Northern Asia (excluding China), and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus derasofasciatus has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes2

eDNA detections16

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

1Tmostly conserved

22Avariable

34Amostly conserved

70Amostly conserved

82Tvariable

103Cvariable

178Amostly conserved

271Amostly conserved

368Amostly conserved

371Gmostly conserved

616Cvariable

TACACTTTATTTTATTTTTGGAGCTTGGTCTGGAATAGTGGGTACAGCATTAAGGCTTTTGGTTCGAGCAGAGCTAGGTAATCCTGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes4

BIN1

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus sulcicollissame genus14.3%Agrilus ribbeisame genus14.6%Agrilus adelphinussame genus14.8%Agrilus graminissame genus15.0%Agrilus hastulifersame genus15.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 199 records

Wild obs. + sensor906

Museum / vouchered277

Other16

Origin

Native273

Range

Area of Occupancy AOO1 764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 144≤1 km 200≤10 km 465>10 km 29

838 georeferenced · 68 without coordinates

Open the mapobservation + sensor906

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤1 km 7≤10 km 181>10 km 8

196 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence277

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum Górnośląskie w Bytomiulocation not on record	41
Bern, CH	33
IFR-DNFlocation not on record	23
Zürich, CH	20
Fribourg, CH	16
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	13
Musee d'Histoire Naturallelocation not on record	12
Paro, BT	12
Musée de l'Hospice du Grand-Saint-Bernardlocation not on record	9
EJCBlocation not on record	9
Geneva, CH	5
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	4
MZLUlocation not on record	3
Natural History Museum Rotterdamlocation not on record	3
Provincia di Livornolocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Naturkundemuseum Erfurtlocation not on record	2
Department of Molecular Biodiversity, Institute of Systematics and Evolution of Animals of the Polish Academy of Scienceslocation not on record	2
Tartu, EE	2
ASUlocation not on record	2
Uniwersytet Wrocławskilocation not on record	2
Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Scienceslocation not on record	2
NTNU-VMlocation not on record	1
NMOKlocation not on record	1
ZSMlocation not on record	1
Brussels, BE	1
Chicago, US	1
Adam Mickiewicz University in Poznańlocation not on record	1

28 institutions · 225 of 277 vouchered records shown · 49 without an institution code

09Environmental DNA16 detections

Where the DNA of Agrilus derasofasciatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map6 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 5.90–17.3

Seasonal swing summer↔winter20.5 °C

Max temp (day)18.4 °C 9.70–22.0

Min temp (night)8.90 °C 1.10–11.4

Precipitation82.6 mm/mo 40.8–108

Air humidity61.4 % 56.8–65.9

Moisture balance-13.5 mm/mo -53.9–28.8

Vapour deficit627 Pa 370–859

Wind speed2.40 m/s 1.80–2.90

Cloud cover40.2 % 34.6–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrilus derasofasciatus

At a glance

Sources7 archives

At a glance

Record type1 199 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 199 records