Agonopterix lythrella

Walsingham, 1889 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records173

Data sources7

Biological traits0

DNA specimens33

eDNA detections32

Sources7 archives

Databases and archives Agonopterix lythrella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility173 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF173 records

Environmental DNA1 datasets · 2 countries32 detections

DNA & barcodingBOLD33 specimens

01Narrative

Agonopterix lythrella is a moth in the family Depressariidae. It was described by Walsingham in 1889. It is found in North America, where it has been recorded from Illinois, Maine, Maryland, Massachusetts, Michigan, Minnesota, New Brunswick, New Hampshire, New York, North Carolina, Nova Scotia, Ohio, Ontario and Saskatchewan.mothphotographersgroup The wingspan is about 15 mm. The forewings are tawny-reddish, dusted with fuscous and pale cinereous towards the costa. There is a pale cinereous basal patch with a distinct spot on its lower half. There is also a curved black spot before the middle of the wing, edged with reddish and followed by cinereous scales. The hindwings are brownish-grey.Insect Life 1 (8): 257 The larvae feed on Lythrum alatum, Hypericum punctatum and Hypericum virginicum.Agonopterix at funet

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix lythrella has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes1

eDNA detections32

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

28Gmostly conserved

106Tmostly conserved

157Tmostly conserved

178Tmostly conserved

385Cmostly conserved

494Tmostly conserved

508Gmostly conserved

634Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGGGCAGGAATAGTAGGGACATCTTTAAGATTATTAATTCGTGCTGAATTAGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.36%

Haplotypes6

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix liturosasame genus4.3%Agonopterix conterminellasame genus4.4%Agonopterix gelidellasame genus5.3%Agonopterix arcticasame genus5.9%Agonopterix rimulellasame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type173 records

Wild obs. + sensor93

Museum / vouchered80

Range

Area of Occupancy AOO360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 60≤1 km 9≤10 km 4>10 km 9

82 georeferenced · 11 without coordinates

Open the mapobservation + sensor93

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 14≤10 km 12>10 km 2

28 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence80

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	16
Philadelphia, US	15
New Haven, US	7
East Lansing, US	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Mississippi State, US	4
Smithsonian Institution, National Museum of Natural Historylocation not on record	3
Cornell University Insect Collectionlocation not on record	3
North Carolina State University Insect Museumlocation not on record	2
Royal Saskatchewan Museumlocation not on record	1

10 institutions · 61 of 80 vouchered records shown · 19 without an institution code

09Environmental DNA32 detections

Where the DNA of Agonopterix lythrella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map2 countries0

1. Forest & WoodlandForestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.9 °C 18.4–21.2

Seasonal swing summer↔winter27.7 °C

Max temp (day)24.0 °C 22.4–25.5

Min temp (night)17.4 °C 15.0–18.4

Precipitation81.3 mm/mo 76.7–103

Air humidity60.5 % 58.8–61.0

Moisture balance-51.9 mm/mo -69.1–-24.8

Vapour deficit926 Pa 824–1,024

Wind speed3.20 m/s 2.50–4.80

Cloud cover40.8 % 39.4–42.8

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)