Agonopterix liturosa

Haworth, 1811 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records4 305

Data sources7

Biological traits2

DNA specimens70

eDNA detections88

Sources7 archives

Databases and archives Agonopterix liturosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 305 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI88 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics70 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 305 records

Environmental DNA3 datasets · 13 countries88 detections

DNA & barcodingBOLD70 specimens

01Narrative

Agonopterix liturosa is a moth of the family Depressariidae. It is found in most of Europe (except most of the Balkan Peninsula). It is also found in the Near East and the eastern part of the Palearctic realm. Shoot of Hypericum with apical leaves drawn together by larva Larva The wingspan is 17 –. Adults are on wing from July to August. The larvae feed on Hypericum species. They spin together the shoots of their host plant and feed from within. Larvae can be found from May to June. They are whitish grey-green with a silky sheen and a yellowish brown head.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding70 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix liturosa has left across the world's sequence archives.

At a glance

DNA specimens70

BINs1

Marker genes1

eDNA detections88

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus63 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

101Gmostly conserved

103Tmostly conserved

125Gmostly conserved

217Amostly conserved

268Amostly conserved

271Cmostly conserved

373Tvariable

598Tmostly conserved

625Tmostly conserved

649Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGGACATCTTTAAGATTATTAATTCGTGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.44%

Haplotypes13

BIN1

Most divergent pair1.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix lythrellasame genus4.3%Agonopterix conterminellasame genus4.7%Agonopterix gelidellasame genus5.3%Agonopterix arcticasame genus5.9%Agonopterix rimulellasame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 305 records

Wild obs. + sensor2 645

Museum / vouchered1 585

Other75

Range

Area of Occupancy AOO6 664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 1 224≤1 km 577≤10 km 676>10 km 2

2 479 georeferenced · 166 without coordinates

Open the mapobservation + sensor2 645

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 360≤1 km 296≤10 km 762>10 km 38

1 456 georeferenced · 129 without coordinates

Open the institutions mapphysical evidence1 585

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	774
DanishLepidopterologicalSocietylocation not on record	225
NHMOlocation not on record	108
Tartu, EE	59
Provincia di Livornolocation not on record	46
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	41
Kuopio, FI	38
Philadelphia, US	38
SLU Artdatabankenlocation not on record	29
Salzburg, AT	19
NTNU-VMlocation not on record	17
Stockholm, SE	12
Tallinn, EE	11
Rovaniemi, FI	8
ZMAAlocation not on record	6
New Haven, US	4
Nijmegen, NL	4
neflocation not on record	4
Natural History Museum Rotterdamlocation not on record	4
RMZlocation not on record	3
ZSMlocation not on record	3
BOLDlocation not on record	3
BioFokuslocation not on record	3
European Distributed Institute of Taxonomy (EDIT)location not on record	2
South Kensington, GB	2
Trondheim, NO	2
Research Collection of Theo Gruenewaldlocation not on record	2
Natural History Museum, Londonlocation not on record	2
University of Kaiserslauternlocation not on record	1
Tilburg, NL	1
Bavarian State Collection of Zoologylocation not on record	1
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
CM, BOLDlocation not on record	1

34 institutions · 1 475 of 1 585 vouchered records shown · 110 without an institution code

09Environmental DNA88 detections

Where the DNA of Agonopterix liturosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found88

Studies independent surveys3

Countries13

Verifiable raw sequence linked22

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 88 detections have coordinates

Open the map13 countries0

14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 11.2–18.0

Seasonal swing summer↔winter18.6 °C

Max temp (day)19.7 °C 14.8–22.6

Min temp (night)12.2 °C 6.50–14.5

Precipitation69.7 mm/mo 52.1–126

Air humidity60.5 % 56.2–62.9

Moisture balance-27.3 mm/mo -70.1–36.4

Vapour deficit728 Pa 512–900

Wind speed2.80 m/s 2.10–4.60

Cloud cover40.6 % 33.4–45.9

CHELSA 1981–2010, ~9 km grid, at location & month of 84 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agonopterix liturosa

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type4 305 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 305 records