Agonopterix conterminella

Zeller, 1839 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records2 063

Data sources7

Biological traits2

DNA specimens49

eDNA detections114

Sources7 archives

Databases and archives Agonopterix conterminella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 063 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI114 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 063 records

Environmental DNA3 datasets · 10 countries114 detections

DNA & barcodingBOLD49 specimens

01Narrative

Agonopterix conterminella is a moth of the family Depressariidae which is found in Asia, Europe and North America. It was first described by Philipp Christoph Zeller in 1839 from a specimen found in Augsburg, Germany. The larva feed on the terminal shoots of willows.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix conterminella has left across the world's sequence archives.

At a glance

DNA specimens49

BINs1

Marker genes1

eDNA detections114

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

1Avariable

82Tvariable

88Gvariable

322Tvariable

337Avariable

340Tvariable

508Amostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTACTCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.61%

Haplotypes8

BIN1

Most divergent pair1.4%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix lythrellasame genus4.4%Agonopterix liturosasame genus4.7%Agonopterix gelidellasame genus5.2%Agonopterix arcticasame genus5.3%Agonopterix rimulellasame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 063 records

Wild obs. + sensor1 476

Museum / vouchered560

Other27

Origin

Native3

Range

Area of Occupancy AOO3 556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 664≤1 km 312≤10 km 406>10 km 1

1 383 georeferenced · 93 without coordinates

Open the mapobservation + sensor1 476

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 144≤1 km 107≤10 km 223>10 km 9

483 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence560

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	195
DanishLepidopterologicalSocietylocation not on record	108
NHMOlocation not on record	39
SLU Artdatabankenlocation not on record	21
Rovaniemi, FI	11
Provincia di Livornolocation not on record	10
RMZlocation not on record	10
Tartu, EE	9
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
Salzburg, AT	6
Stockholm, SE	6
NTNU-VMlocation not on record	5
Durban Natural Science Museumlocation not on record	5
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	5
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	4
Philadelphia, US	4
ZSMlocation not on record	2
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	2
Edmonton, CA	2
Bavarian State Collection of Zoologylocation not on record	2
neflocation not on record	2
Research Collection of Peter Lichtmanneckerlocation not on record	2
Tallinn, EE	1
Kuopio, FI	1
Metsähallituslocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Research Collection of Daniel Handfieldlocation not on record	1
Nijmegen, NL	1
Tilburg, NL	1
South Kensington, GB	1

31 institutions · 465 of 560 vouchered records shown · 95 without an institution code

09Environmental DNA114 detections

Where the DNA of Agonopterix conterminella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found114

Studies independent surveys3

Countries10

Verifiable raw sequence linked53

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 114 detections have coordinates

Open the map10 countries0

Floodplain forestUrban1. Forest & Woodland|1.4. Temperate ForestMixed habitat1. Forest & Woodland|1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 9.80–17.5

Seasonal swing summer↔winter21.6 °C

Max temp (day)19.0 °C 12.6–22.2

Min temp (night)11.1 °C 6.20–13.4

Precipitation88.3 mm/mo 60.3–108

Air humidity60.3 % 58.0–64.5

Moisture balance-15.5 mm/mo -54.7–32.5

Vapour deficit672 Pa 430–830

Wind speed2.50 m/s 2.00–4.10

Cloud cover49.3 % 32.2–58.9

CHELSA 1981–2010, ~9 km grid, at location & month of 112 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agonopterix conterminella

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type2 063 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 063 records