Agonopterix gelidella

(Busck, 1908) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records79

Data sources7

Biological traits0

DNA specimens37

eDNA detections36

Sources7 archives

Databases and archives Agonopterix gelidella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility79 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF79 records

Environmental DNA1 datasets · 1 countries36 detections

DNA & barcodingBOLD37 specimens

01Narrative

Agonopterix gelidella is a moth in the family Depressariidae. It was described by August Busck in 1908. It is found in North America, where it has been recorded from Alberta, Maine, Manitoba and North Carolina.Moth Photographers Group The wingspan is about 20 mm. The forewings are dark purplish fuscous, sprinkled with black scales. There is a transverse yellowish-white streak near the base from the dorsal edge to near the costa. There is a crescent-shaped black streak on the disc and a small round black dot at the end of the cell, posteriorly edged with white. The costal edge is mottled with black and yellowish white. The hindwings are light yellowish fuscous.Proceedings of the Entomological Society of Washington 9 (1-4): 90 The larvae feed on Salix species and Betula papyrifera.Agonopterix at Markku Savela's Lepidoptera and Some Other Life Forms

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix gelidella has left across the world's sequence archives.

At a glance

DNA specimens37

BINs1

Marker genes1

eDNA detections36

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

67Avariable

118Cmostly conserved

217Amostly conserved

268Gmostly conserved

271Gmostly conserved

403Gmostly conserved

421Avariable

523Tmostly conserved

625Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTAACCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes7

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix arcticasame genus2.6%Agonopterix conterminellasame genus5.2%Agonopterix lythrellasame genus5.3%Agonopterix liturosasame genus5.3%Agonopterix rimulellasame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type79 records

Museum / vouchered79

Range

Area of Occupancy AOO100 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 6

6 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence79

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	20
University of Guelph, Centre for Biodiversity Genomicslocation not on record	19
Edmonton, CA	4
Royal Saskatchewan Museumlocation not on record	2
San Francisco, US	2
Centre for Biodiversity Genomicslocation not on record	1
Research Collection of Daniel Handfieldlocation not on record	1

7 institutions · 49 of 79 vouchered records shown · 30 without an institution code

09Environmental DNA36 detections

Where the DNA of Agonopterix gelidella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map1 country0

ForestMixed HabitatWetlandMixed habitat1. Forest & Woodland1. Forest & Woodland|1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 10.0–13.9

Seasonal swing summer↔winter36.8 °C

Max temp (day)15.1 °C 14.2–20.0

Min temp (night)7.90 °C 6.40–8.70

Precipitation89.9 mm/mo 56.4–96.1

Air humidity61.6 % 55.9–63.1

Moisture balance-10.4 mm/mo -75.0–20.7

Vapour deficit510 Pa 452–709

Wind speed2.50 m/s 2.00–3.90

Cloud cover47.7 % 36.2–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)