Agelenopsis potteri

(Blackwall, 1846) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Agelenidae/Agelenopsis

At a glance

Occurrence records856

Data sources9

Biological traits0

DNA specimens210

eDNA detections268

Sources9 archives

Databases and archives Agelenopsis potteri's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility856 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI268 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics210 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~3.56 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF856 records

Environmental DNA1 datasets · 3 countries268 detections

DNA & barcodingBOLD210 specimens

Genome at a glanceGoaT3.6 Gbp

01Narrative

Agelenopsis potteri is a species of funnel weaver in the spider family Agelenidae. Native to North America, it has been introduced into Ukraine, Russia, and Kirgizstan.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding210 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelenopsis potteri has left across the world's sequence archives.

At a glance

DNA specimens210

BINs1

Marker genes1

eDNA detections268

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus171 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

67Gmostly conserved

88Gmostly conserved

337Cvariable

340Tmostly conserved

610Cmostly conserved

TACTTTATATTTGATTTTTGGTGCTTGGTCTGCAATAGTAGGAACAGCAATAAGAGTTTTGATTCGGATTGAATTAGGTCAGCCTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.60%

Haplotypes18

BIN1

Most divergent pair2.7%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agelenopsis naeviasame genus4.6%Agelenopsis oklahomasame genus5.3%Agelenopsis apertasame genus6.2%Agelenopsis utahanasame genus7.8%Agelenopsis oregonensissame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Agelenopsis potteri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 559 920 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Agelenopsis potteri3.56 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type856 records

Wild obs. + sensor364

Museum / vouchered491

Other1

Range

Area of Occupancy AOO1 896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 198≤1 km 47≤10 km 25>10 km 39

309 georeferenced · 55 without coordinates

Open the mapobservation + sensor364

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 1≤1 km 10≤10 km 60>10 km 4

75 georeferenced · 416 without coordinates

Open the institutions mapphysical evidence491

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	115
University of Guelph, Centre for Biodiversity Genomicslocation not on record	89
Denver, US	86
Saint John, CA	25
Royal Saskatchewan Museumlocation not on record	8
Champaign, US	8
WIlocation not on record	7
Chicago, US	5
Royal Ontario Museumlocation not on record	4
Ohio State University Acarology Laboratorylocation not on record	2
Centre for Biodiversity Genomicslocation not on record	1
Biodiversity Institute of Ontariolocation not on record	1
Albuquerque, US	1

13 institutions · 352 of 491 vouchered records shown · 139 without an institution code

09Environmental DNA268 detections

Where the DNA of Agelenopsis potteri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found268

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 268 detections have coordinates

Open the map3 countries0

Wetlandunder rockMixed habitatGrasslandon buildingrunning on side walk at night

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 14.3–22.2

Seasonal swing summer↔winter26.4 °C

Max temp (day)23.0 °C 18.5–26.7

Min temp (night)15.5 °C 11.1–18.6

Precipitation87.7 mm/mo 76.7–106

Air humidity59.6 % 57.8–61.6

Moisture balance-32.7 mm/mo -65.1–9.40

Vapour deficit850 Pa 647–1,088

Wind speed3.10 m/s 2.40–4.90

Cloud cover41.8 % 36.1–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 259 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)