Agelenopsis naevia

(Walckenaer, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Agelenidae/Agelenopsis

At a glance

Occurrence records260

Data sources9

Biological traits2

DNA specimens12

eDNA detections12

Sources9 archives

Databases and archives Agelenopsis naevia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility260 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

World Spider Trait DBMasaryk University2 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources2 traits

Occurrence & distributionGBIF260 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD12 specimens

01Narrative

Agelenopsis naevia is a species of funnel weaver in the family Agelenidae. It is found in the United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBirkhofer & Wolters 2012Pekár et al. 2012a

Predation2

Prey OrderAraneae

Prey diversity8.11 mm

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelenopsis naevia has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Diversity (π)2.6%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 65 variable positions, in barcode order

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

21Gmostly conserved

23Gmostly conserved

24Cmostly conserved

25Tmostly conserved

27Gmostly conserved

28Gmostly conserved

29Tmostly conserved

31Tmostly conserved

32Gmostly conserved

33Cmostly conserved

35Amostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

47Gmostly conserved

48Cmostly conserved

51Tmostly conserved

53Amostly conserved

54Gmostly conserved

55Amostly conserved

56Gmostly conserved

58Tmostly conserved

59Tmostly conserved

61Gmostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

68Amostly conserved

69Tmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

73Gmostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

79Tmostly conserved

81Amostly conserved

82Amostly conserved

83Cmostly conserved

84Cmostly conserved

85Cmostly conserved

86Gmostly conserved

88Gmostly conserved

89Amostly conserved

90Gmostly conserved

91Amostly conserved

93Amostly conserved

94Tmostly conserved

95Tmostly conserved

96Tmostly conserved

97Gmostly conserved

99Gmostly conserved

132Tvariable

350Tvariable

526Amostly conserved

TACTCTATATTTGATTTTTGGTGCTTGGTCTGCAATAGTAGGAACAGCAATAAGAGTTTTGATTCGAATTGAGTTAGGTCAACCCGGGAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agelenopsis pennsylvanicasame genus4.6%Agelenopsis potterisame genus4.6%Agelenopsis emertonisame genus4.6%Agelenopsis oklahomasame genus6.1%Agelenopsis apertasame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type260 records

Wild obs. + sensor164

Museum / vouchered96

Range

Area of Occupancy AOO892 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 82≤1 km 16≤10 km 14>10 km 20

132 georeferenced · 32 without coordinates

Open the mapobservation + sensor164

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 4≤1 km 7≤10 km 23>10 km 12

46 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence96

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratorylocation not on record	32
Sam Noble Oklahoma Museum of Natural Historylocation not on record	24
Cambridge, US	18
Denver, US	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Albuquerque, US	1
Saint John, CA	1
Copenhagen, DK	1
Champaign, US	1
US	1

10 institutions · 89 of 96 vouchered records shown · 7 without an institution code

09Environmental DNA12 detections

Where the DNA of Agelenopsis naevia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

prairieMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 22.2–28.6

Seasonal swing summer↔winter27.0 °C

Max temp (day)26.7 °C 26.7–34.1

Min temp (night)18.6 °C 18.6–24.4

Precipitation80.1 mm/mo 80.1–87.0

Air humidity59.1 % 57.6–59.1

Moisture balance-60.2 mm/mo -94.7–-60.2

Vapour deficit1,088 Pa 1,088–1,656

Wind speed2.90 m/s 2.00–2.90

Cloud cover36.1 % 27.2–36.1

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)