Agelenopsis utahana

(Chamberlin & Ivie, 1933) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Agelenidae/Agelenopsis

At a glance

Occurrence records1 057

Data sources9

Biological traits0

DNA specimens525

eDNA detections527

Sources9 archives

Databases and archives Agelenopsis utahana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 057 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI527 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics525 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~4.11 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 057 records

Environmental DNA2 datasets · 2 countries527 detections

DNA & barcodingBOLD525 specimens

Genome at a glanceGoaT4.1 Gbp

01Narrative

Agelenopsis utahana is a species of funnel weaver in the spider family Agelenidae. It is found in the United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding525 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelenopsis utahana has left across the world's sequence archives.

At a glance

DNA specimens525

BINs1

Marker genes1

eDNA detections527

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus464 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

40Amostly conserved

80Cmostly conserved

92Cmostly conserved

103Cmostly conserved

145Amostly conserved

175Tvariable

209Tmostly conserved

220Tmostly conserved

275Cmostly conserved

337Tmostly conserved

340Cmostly conserved

344Cmostly conserved

357Cvariable

358Tmostly conserved

480Cmostly conserved

481Tmostly conserved

556Gmostly conserved

607Tmostly conserved

628Gmostly conserved

TTTATATTTGATTTTTGGTGCTTGGTCCGCTATAGTGGGAACAGCAATAAGAGTTTTAATTCGGATTGAGTTAGGTCAACCTGGGAGATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 80 variants.

Diversity (π)1.7%

Haplotypes80

BIN1

Most divergent pair6.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agelenopsis oregonensissame genus2.0%Agelenopsis pennsylvanicasame genus7.8%Agelenopsis potterisame genus7.8%Agelenopsis emertonisame genus7.8%Agelenopsis naeviasame genus8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Agelenopsis utahana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 107 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Agelenopsis utahana4.11 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type1 057 records

Wild obs. + sensor47

Museum / vouchered1 010

Range

Area of Occupancy AOO1 428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 27≤1 km 7≤10 km 2>10 km 1

37 georeferenced · 10 without coordinates

Open the mapobservation + sensor47

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 37≤1 km 31≤10 km 39>10 km 12

119 georeferenced · 891 without coordinates

Open the institutions mapphysical evidence1 010

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	254
Cambridge, US	137
Denver, US	72
Edmonton, CA	58
Albuquerque, US	31
University of Alberta Museums (UAM)location not on record	29
Ohio State University Acarology Laboratorylocation not on record	27
WIlocation not on record	22
Saint John, CA	8
Chicago, US	5
DOI/FWS, Kenai National Wildlife Refugelocation not on record	3
Vancouver, CA	3
Royal Saskatchewan Museumlocation not on record	3
Royal Ontario Museumlocation not on record	3
Centre for Biodiversity Genomicslocation not on record	2
University of Alaska Museumlocation not on record	1
Frankfurt am Main	1

17 institutions · 659 of 1 010 vouchered records shown · 351 without an institution code

09Environmental DNA527 detections

Where the DNA of Agelenopsis utahana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found527

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 527 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland | 1.1. Boreal Forest5. Wetlands (inland) | 5.4. Bogs, Marshes, S…UrbanWetlandMixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 11.4–20.7

Seasonal swing summer↔winter26.9 °C

Max temp (day)21.5 °C 15.4–24.6

Min temp (night)13.8 °C 6.50–17.8

Precipitation89.0 mm/mo 57.5–118

Air humidity59.4 % 54.9–63.5

Moisture balance-38.2 mm/mo -74.2–21.1

Vapour deficit778 Pa 548–989

Wind speed2.80 m/s 2.00–4.80

Cloud cover41.1 % 35.5–51.4

CHELSA 1981–2010, ~9 km grid, at location & month of 518 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agelenopsis utahana

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Record type1 057 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 057 records