Agathodes musivalis

Guenée, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Agathodes

At a glance

Occurrence records262

Data sources7

Biological traits0

DNA specimens5

eDNA detections10

Sources7 archives

Databases and archives Agathodes musivalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility262 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF262 records

Environmental DNA1 datasets · 9 countries10 detections

DNA & barcodingBOLD5 specimens

01Narrative

Agathodes musivalis is a species of moth of the family Crambidae described by Achille Guenée in 1854. It is found in Mayotte, Congo, Kenya, Réunion, Malawi, Mauritius, Madagascar, Mozambique, Somalia, South Africa, Uganda, Zambia and Zimbabwe. The larvae have been recorded feeding on Erythrina indica and Erythrina caffra (Fabaceae).Guillermet, C. 2009Ghesquière, J. 1942 The common name is Painted Pearl.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agathodes musivalis has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections10

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

184Tmostly conserved

343Amostly conserved

547Tvariable

622Gmostly conserved

TACATTATATTTTATTTTTGGAATTTGAAGAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCAGAATTAGGTAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.27%

Haplotypes4

BIN1

Most divergent pair0.46%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agathodes monstralissame genus5.2%Agathodes designalissame genus5.5%Agathodes ostentalissame genus5.5%Omiodes simialissame family5.9%Omiodes alboanalissame family6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type262 records

Wild obs. + sensor239

Museum / vouchered23

Range

Area of Occupancy AOO492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 139≤1 km 31≤10 km 6>10 km 10

186 georeferenced · 53 without coordinates

Open the mapobservation + sensor239

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 1≤10 km 5

6 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban Natural Science Museumlocation not on record	14
New Haven, US	3
Natural History Museum Rotterdamlocation not on record	2
Nagatoro-machi, Chichibu-gun, JP	1
Cape Town, ZA	1
ZSMlocation not on record	1

6 institutions · 22 of 23 vouchered records shown · 1 without an institution code

09Environmental DNA10 detections

Where the DNA of Agathodes musivalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map9 countries0

Forest / savannah patchwork

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 20.9–26.1

Seasonal swing summer↔winter2.40 °C

Max temp (day)27.7 °C 25.1–31.5

Min temp (night)21.7 °C 19.2–23.8

Precipitation160 mm/mo 58.2–323

Air humidity65.3 % 60.1–71.0

Moisture balance26.0 mm/mo

Vapour deficit1,094 Pa 814–1,262

Wind speed1.10 m/s

Cloud cover36.6 % 24.0–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)