Agathodes ostentalis

Geyer, 1837 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Agathodes

At a glance

Occurrence records737

Data sources7

Biological traits0

DNA specimens59

eDNA detections44

Sources7 archives

Databases and archives Agathodes ostentalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility737 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI44 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics59 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF737 records

Environmental DNA1 datasets · 2 countries44 detections

DNA & barcodingBOLD59 specimens

01Narrative

Agathodes ostentalis, the coral tree moth, is a species of moth of the family Crambidae described by Carl Geyer in 1837. It is found from India to Indonesia, including Hong Kong, Japan, Thailand and in Australia in New South Wales and Queensland. The wingspan is about 25 mm. The larvae have been recorded feeding on the foliage Erythrina indica and Erythrina vespertillio.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding59 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agathodes ostentalis has left across the world's sequence archives.

At a glance

DNA specimens59

BINs8

Marker genes2

eDNA detections44

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus48 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 53 variable positions, in barcode order

1Avariable

22Amostly conserved

49Avariable

55Tvariable

79Tvariable

85Avariable

127Tmostly conserved

154Tmostly conserved

157Tmostly conserved

184Avariable

190Amostly conserved

193Tvariable

202Tvariable

205Amostly conserved

211Amostly conserved

220Tmostly conserved

232Amostly conserved

235Tvariable

238Tmostly conserved

259Tmostly conserved

266Tmostly conserved

268Amostly conserved

274Amostly conserved

283Tvariable

337Tvariable

340Tvariable

343Amostly conserved

347Cmostly conserved

349Tmostly conserved

352Avariable

358Tmostly conserved

367Tmostly conserved

385Tvariable

400Avariable

401Tvariable

403Avariable

406Tmostly conserved

415Avariable

451Amostly conserved

463Tvariable

475Tvariable

478Amostly conserved

479Tmostly conserved

484Tvariable

556Tmostly conserved

574Avariable

577Amostly conserved

616Tmostly conserved

619Tvariable

622Tvariable

631Avariable

641Cvariable

643Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes10

BINs8

Most divergent pair8.7%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agathodes musivalissame genus5.5%Pycnarmon cribratasame family5.8%Cydalima diaphanalissame family5.8%Talanga sexpunctalissame family5.9%Omiodes alboanalissame family5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type737 records

Wild obs. + sensor707

Museum / vouchered30

Range

Area of Occupancy AOO1 192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 314≤1 km 213≤10 km 50>10 km 23

600 georeferenced · 107 without coordinates

Open the mapobservation + sensor707

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	17
New Haven, US	2
National Museum of Natural Sciencelocation not on record	2
Tallinn, EE	1
Australian National Insect Collectionlocation not on record	1
tesrilocation not on record	1

6 institutions · 24 of 30 vouchered records shown · 6 without an institution code

09Environmental DNA44 detections

Where the DNA of Agathodes ostentalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found44

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 44 detections have coordinates

Open the map2 countries0

Dry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 22.0–23.5

Seasonal swing summer↔winter8.60 °C

Max temp (day)23.8 °C 23.6–27.6

Min temp (night)20.9 °C 17.5–22.1

Precipitation110 mm/mo 83.6–177

Air humidity61.6 % 60.9–62.2

Vapour deficit1,033 Pa 1,009–1,110

Cloud cover27.4 % 26.2–31.1

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)