Agathodes designalis

Guenée, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Agathodes

At a glance

Occurrence records556

Data sources7

Biological traits0

DNA specimens150

eDNA detections150

Sources7 archives

Databases and archives Agathodes designalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility556 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI150 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics150 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF556 records

Environmental DNA1 datasets · 8 countries150 detections

DNA & barcodingBOLD150 specimens

01Narrative

Agathodes designalis, the sky-pointing moth, is a moth in the family Crambidae. It was described by Achille Guenée in 1854. It lives in Arizona, Texas, Florida, southern South America and the West Indies. The length of the forewings is 13-18.5 mm. They are marbled purple and green. The hindwings are beige. Adults are on wing from May to September in four generations in Florida. The larvae feed on Erythrina (including Erythrina flabelliformis), Inga and Citharexylum species. The summer and fall generations feed on the leaves of their host plant, while larvae of the spring generation feed on the flowers. Young larvae are translucent and orange. Older larvae have an orange body with cream stripes and a bright red head.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding150 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agathodes designalis has left across the world's sequence archives.

At a glance

DNA specimens150

BINs3

Marker genes1

eDNA detections150

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus147 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

76Amostly conserved

118Cmostly conserved

202Amostly conserved

220Cmostly conserved

319Amostly conserved

415Gmostly conserved

578Cmostly conserved

613Tmostly conserved

616Tmostly conserved

TACCTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.55%

Haplotypes32

BINs3

Most divergent pair2.6%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agathodes monstralissame genus1.5%Agathodes musivalissame genus5.5%Omiodes palliventralissame family5.9%Agathodes ostentalissame genus6.7%Bradina diagonalissame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type556 records

Wild obs. + sensor78

Museum / vouchered477

Other1

Range

Area of Occupancy AOO680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 34≤1 km 17≤10 km 5>10 km 5

61 georeferenced · 17 without coordinates

Open the mapobservation + sensor78

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 109≤1 km 8≤10 km 7

124 georeferenced · 353 without coordinates

Open the institutions mapphysical evidence477

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	319
Facultad de Ciencias Biológicas y Agropecuarias, Universidad de Colimalocation not on record	106
Mississippi State, US	21
University of Pennsylvanialocation not on record	5
San Diego, US	5
Tapachula, MX	4
The University of the West Indies, Trinidad and Tobagolocation not on record	2
Ciudad de México, MX	2
Vernal, US	2
New Haven, US	2
Smithsonian Tropical Research Institutelocation not on record	2
Denver, US	1
Cornell University Insect Collectionlocation not on record	1
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Essig Museum of Entomologylocation not on record	1
Georgia Museum of Natural Historylocation not on record	1

18 institutions · 477 of 477 vouchered records shown

09Environmental DNA150 detections

Where the DNA of Agathodes designalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found150

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 150 detections have coordinates

Open the map8 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.5. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 20.6–25.9

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.1 °C 24.6–29.1

Min temp (night)21.2 °C 17.4–24.1

Precipitation242 mm/mo 58.6–478

Air humidity69.0 % 63.3–74.7

Moisture balance92.6 mm/mo -102–344

Vapour deficit954 Pa 700–1,178

Wind speed2.10 m/s 0.7–3.80

Cloud cover33.6 % 14.7–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 137 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)