Agathodes monstralis

Guenée, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Agathodes

At a glance

Occurrence records245

Data sources6

Biological traits0

DNA specimens56

eDNA detections65

Sources6 archives

Databases and archives Agathodes monstralis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility245 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics56 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF245 records

Environmental DNA1 datasets · 4 countries65 detections

DNA & barcodingBOLD56 specimens

01Narrative

Agathodes monstralis is een vlinder uit de familie van de grasmotten (Crambidae), uit de onderfamilie van de Spilomelinae. De wetenschappelijke naam van de soort is voor het eerst gepubliceerd in 1854 door Achille Guenée. De lengte van de voorvleugel bedraagt 12 tot 15 millimeter.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding56 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agathodes monstralis has left across the world's sequence archives.

At a glance

DNA specimens56

BINs2

Marker genes1

eDNA detections65

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

31Gmostly conserved

55Amostly conserved

64Tmostly conserved

217Amostly conserved

220Tmostly conserved

274Tmostly conserved

337Tmostly conserved

343Cmostly conserved

355Tmostly conserved

373Amostly conserved

406Cmostly conserved

415Gmostly conserved

424Cmostly conserved

TACCTTATATTTTATTTTTGGTATTTGAGCGGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.49%

Haplotypes14

BINs2

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agathodes designalissame genus1.5%Agathodes musivalissame genus5.2%Omiodes palliventralissame family6.1%Agathodes ostentalissame genus6.1%Patania deficienssame family6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type245 records

Wild obs. + sensor164

Museum / vouchered81

Range

Area of Occupancy AOO344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 99≤1 km 21≤10 km 5>10 km 2

127 georeferenced · 37 without coordinates

Open the mapobservation + sensor164

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 6≤1 km 1≤10 km 66

73 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	65
Mississippi State, US	5
New Haven, US	4
San Francisco, US	2
University of Pennsylvanialocation not on record	2
East Lansing, US	2
Cornell University Insect Collectionlocation not on record	1

7 institutions · 81 of 81 vouchered records shown

09Environmental DNA65 detections

Where the DNA of Agathodes monstralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found65

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 65 detections have coordinates

Open the map4 countries0

3. Shrubland | 3.5. Subtropical/Tropical Dry…1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 22.9–26.2

Seasonal swing summer↔winter2.40 °C

Max temp (day)27.4 °C 25.5–29.9

Min temp (night)21.5 °C 19.9–24.0

Precipitation193 mm/mo 34.8–367

Air humidity67.9 % 62.6–73.2

Moisture balance61.2 mm/mo -104–232

Vapour deficit1,006 Pa 756–1,222

Wind speed2.30 m/s 1.10–6.40

Cloud cover32.9 % 15.1–46.1

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)