Aethes triangulana

(Treitschke, 1835) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records628

Data sources8

Biological traits0

DNA specimens8

eDNA detections8

Sources8 archives

Databases and archives Aethes triangulana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility628 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF628 records

Environmental DNA2 datasets · 5 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Aethes triangulana is a moth of the family Tortricidae. It was described by Treitschke in 1835. It is found from most of Europe to Central Asia, the Amur region, China and Japan. The wingspan is 18 –. The moth flies from May to June. The larvae feed on Veronica longifolia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes triangulana has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P639 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

87Cmostly conserved

99Cvariable

129Avariable

178Tmostly conserved

181Gmostly conserved

183Cvariable

193Tmostly conserved

210Avariable

212Cmostly conserved

216Tmostly conserved

264Avariable

288Avariable

345Cvariable

360Avariable

381Tmostly conserved

388Cmostly conserved

399Cmostly conserved

444Tmostly conserved

531Cvariable

537Avariable

559Cmostly conserved

609Gmostly conserved

GGTATTTGAGCAGGTATAGTTGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGTAACCCTGGATCATTAATTGGAGACGACCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes5

BIN1

Most divergent pair2.7%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes kindermannianasame genus7.5%Aethes rubiganasame genus7.7%Aethes cnicanasame genus7.8%Aethes margaritanasame genus8.0%Aethes smeathmannianasame genus8.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type628 records

Wild obs. + sensor466

Museum / vouchered162

Range

Area of Occupancy AOO972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 209≤1 km 110≤10 km 126>10 km 3

448 georeferenced · 18 without coordinates

Open the mapobservation + sensor466

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 32≤1 km 58≤10 km 20

110 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence162

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	36
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	21
Metsähallituslocation not on record	17
Rovaniemi, FI	17
NHMOlocation not on record	13
SLU Artdatabankenlocation not on record	10
DanishLepidopterologicalSocietylocation not on record	7
Stockholm, SE	6
Uniwersytet Łódzkilocation not on record	6
Kuopio, FI	3
Provincia di Livornolocation not on record	3
Philadelphia, US	1
Tallinn, EE	1
Research Collection of Kai Berggrenlocation not on record	1

14 institutions · 142 of 162 vouchered records shown · 20 without an institution code

09Environmental DNA8 detections

Where the DNA of Aethes triangulana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys2

Countries5

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map5 countries0

grazed meadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 10.5–17.4

Seasonal swing summer↔winter21.7 °C

Max temp (day)17.1 °C 12.0–21.8

Min temp (night)9.20 °C 6.70–12.3

Precipitation66.4 mm/mo 56.6–101

Air humidity57.3 % 56.1–65.6

Moisture balance-37.6 mm/mo -71.6–0.3

Vapour deficit670 Pa 477–874

Wind speed3.30 m/s 2.30–4.90

Cloud cover40.9 % 32.1–54.5

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)