Aethes cnicana

(Westwood, 1854) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aethes

At a glance

Occurrence records5 570

Data sources7

Biological traits2

DNA specimens75

eDNA detections3

Sources7 archives

Databases and archives Aethes cnicana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility5 570 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics75 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF5 570 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD75 specimens

Genome at a glanceGoaT≈412 Mbp

01Narrative

Aethes cnicana is a moth of the family Tortricidae. It was described by Westwood in 1854. It is found in Europe, China (Beijing, Heilongjiang, Inner Mongolia, Jilin, Liaoning, Tianjin), Japan, Korea and Russia. The wingspan is 14 –. Very similar to Ancylis badiana but differs as follows : forewings with markings bright ferruginous-brown,antemedian fascia less angulated, less distinctly interrupted,not dilated on dorsum. Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description Julius von Kennel provides a full description.Julius von Kennel, 1921, The Palaearktischen Tortriciden, eine monographische Darstellung. Stuttgart: E. Schweizerbart'sche Verlagsbuchhandlung. 742 pp. - Palaearctic Tortricidae, a monograph.pdf at Zobodat 247 The moth flies from May to July and are often attracted to light. The larvae feed on Cirsium.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding75 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aethes cnicana has left across the world's sequence archives.

At a glance

DNA specimens75

BINs1

Marker genes2

eDNA detections3

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus71 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

28Gmostly conserved

160Amostly conserved

193Cmostly conserved

214Cmostly conserved

250Tmostly conserved

284Tmostly conserved

358Cvariable

364Cmostly conserved

373Tmostly conserved

616Cmostly conserved

634Tmostly conserved

646Cmostly conserved

AACACTATATTTTATTTTTGGTATTTGGGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAACCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes19

BIN1

Most divergent pair2.0%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethes kyrkiisame genus4.9%Aethes margaritanasame genus6.8%Aethes tesseranasame genus7.1%Aethes kindermannianasame genus7.1%Aethes scalanasame genus7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Aethes cnicana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈412 259 526 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aethes cnicana0.41 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness90% BUSCO

08Occurrence & distribution

Record type5 570 records

Wild obs. + sensor4 783

Museum / vouchered702

Other85

Range

Area of Occupancy AOO9 224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 2 163≤1 km 1 155≤10 km 1 132>10 km 8

4 458 georeferenced · 325 without coordinates

Open the mapobservation + sensor4 783

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 255≤1 km 261≤10 km 102

618 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence702

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	202
NHMOlocation not on record	73
Tartu, EE	72
Provincia di Livornolocation not on record	54
Kuopio, FI	41
SLU Artdatabankenlocation not on record	32
Salzburg, AT	30
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	17
Rovaniemi, FI	10
DABUHlocation not on record	8
Nijmegen, NL	6
Stockholm, SE	5
ZSMlocation not on record	5
Natural History Museum Rotterdamlocation not on record	5
neflocation not on record	5
ZMAAlocation not on record	5
South Kensington, GB	3
Philadelphia, US	2
University of Kaiserslauternlocation not on record	2
NMBU:MINAlocation not on record	2
Iwate Prefectural Museumlocation not on record	1
BioFokuslocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Helsinki, FI	1
Metsähallituslocation not on record	1
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1
SZOPKlocation not on record	1
KIRMlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Research Collection of F. Graflocation not on record	1

30 institutions · 589 of 702 vouchered records shown · 113 without an institution code

09Environmental DNA3 detections

Where the DNA of Aethes cnicana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 15.7–17.0

Seasonal swing summer↔winter19.1 °C

Max temp (day)20.5 °C 19.7–21.2

Min temp (night)11.5 °C 11.1–11.9

Precipitation75.5 mm/mo 70.1–80.9

Air humidity58.5 % 58.2–58.8

Moisture balance-45.6 mm/mo -51.1–-40.0

Vapour deficit775 Pa 737–812

Wind speed3.30 m/s 2.60–4.10

Cloud cover35.9 % 35.0–36.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aethes cnicana

At a glance

Sources7 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 570 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 570 records