Aedes theobaldi

(Taylor, 1914) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records455

Data sources4

Biological traits0

DNA specimens14

eDNA detections13

Sources4 archives

Databases and archives Aedes theobaldi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility455 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF455 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD14 specimens

01Narrative

Ochlerotatus theobaldi is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1914 door Taylor.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes theobaldi has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes2

eDNA detections13

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P630 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

60Gvariable

66Cmostly conserved

72Amostly conserved

78Tmostly conserved

153Gvariable

156Avariable

162Amostly conserved

174Tmostly conserved

192Cvariable

288Gvariable

291Amostly conserved

330Avariable

342Tmostly conserved

345Avariable

384Cmostly conserved

387Gvariable

405Gmostly conserved

480Amostly conserved

508Tmostly conserved

513Amostly conserved

514Cvariable

522Amostly conserved

534Chighly variable

549Avariable

567Tvariable

606Cmostly conserved

TCCGGAATAGTAGGAACATCTTTAAGTGTATTAATTCGAGCTGAATTAAGTCATCCAGGGATATTCATTGGAAATGATCAAATTTATAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes3

BIN1

Most divergent pair2.5%

OtherOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes normanensissame genus5.7%Aedes antipodeussame genus6.5%Aedes procaxsame genus6.9%Aedes canadensissame genus7.8%Aedes cantatorsame genus8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type455 records

Wild obs. + sensor2

Museum / vouchered453

Range

Area of Occupancy AOO268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1>10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 1≤10 km 5

6 georeferenced · 447 without coordinates

Open the institutions mapphysical evidence453

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Queensland Insect Collectionlocation not on record	223
Natick, US	218
Museums Victorialocation not on record	7
Australian National Fish Collectionlocation not on record	4
Champaign, US	1

5 institutions · 453 of 453 vouchered records shown

09Environmental DNA13 detections

Where the DNA of Aedes theobaldi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 17.9–23.5

Seasonal swing summer↔winter14.2 °C

Max temp (day)23.7 °C 23.7–29.5

Min temp (night)11.9 °C 11.9–17.7

Precipitation43.0 mm/mo 25.9–43.0

Air humidity52.4 % 44.6–52.4

Moisture balance-120 mm/mo -120–-100

Vapour deficit978 Pa 978–1,596

Wind speed4.40 m/s 3.50–4.40

Cloud cover23.9 % 15.7–23.9

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)