Aedes procax

(Skuse, 1889) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records527

Data sources4

Biological traits0

DNA specimens16

eDNA detections16

Sources4 archives

Databases and archives Aedes procax's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility527 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF527 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD16 specimens

01Narrative

Ochlerotatus procax is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1889 door Skuse.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes procax has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P606 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

30Tmostly conserved

54Tmostly conserved

150Cmostly conserved

168Cmostly conserved

186Tvariable

276Amostly conserved

288Cmostly conserved

291Tmostly conserved

318Gmostly conserved

363Avariable

537Tvariable

576Avariable

AGAGTATTAATTCGTGCTGAATTAAGTCATCCAGGAATATTTATTGGAAATGATCAAATTTATAATGTAATTGTTACAGCTCATGCATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.65%

Haplotypes5

BIN1

Most divergent pair1.3%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes theobaldisame genus6.9%Aedes caballussame genus7.4%Aedes ventrovittissame genus7.8%Aedes vigilaxsame genus7.8%Aedes sierrensissame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type527 records

Wild obs. + sensor105

Museum / vouchered422

Range

Area of Occupancy AOO444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 99≤1 km 4>10 km 1

104 georeferenced · 1 without coordinates

Open the mapobservation + sensor105

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤10 km 4

5 georeferenced · 417 without coordinates

Open the institutions mapphysical evidence422

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	210
University of Queensland Insect Collectionlocation not on record	207
Australian National Fish Collectionlocation not on record	3
Museums Victorialocation not on record	1
Sydney, AU	1

5 institutions · 422 of 422 vouchered records shown

09Environmental DNA16 detections

Where the DNA of Aedes procax was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 18.0–22.4

Seasonal swing summer↔winter9.20 °C

Max temp (day)22.7 °C 20.6–24.9

Min temp (night)18.0 °C 15.7–20.2

Precipitation88.8 mm/mo 78.3–99.2

Air humidity59.7 % 58.2–61.1

Moisture balance-44.6 mm/mo -82.4–-6.80

Vapour deficit958 Pa 868–1,047

Wind speed2.60 m/s

Cloud cover30.4 % 27.7–33.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)