Aedes vigilax

(Skuse, 1889) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records1 942

Data sources6

Biological traits0

DNA specimens189

eDNA detections185

Sources6 archives

Databases and archives Aedes vigilax's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 942 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI185 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics189 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 942 records

Environmental DNA3 datasets · 3 countries185 detections

DNA & barcodingBOLD189 specimens

01Narrative

Ochlerotatus vigilax is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1889 door Skuse.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding189 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes vigilax has left across the world's sequence archives.

At a glance

DNA specimens189

BINs3

Marker genes11

eDNA detections185

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus179 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

55Gmostly conserved

57Amostly conserved

87Tmostly conserved

123Tmostly conserved

231Tmostly conserved

315Gmostly conserved

339Tmostly conserved

363Cmostly conserved

414Amostly conserved

415Amostly conserved

435Tmostly conserved

465Amostly conserved

489Cmostly conserved

498Amostly conserved

507Gmostly conserved

546Amostly conserved

561Tmostly conserved

564Amostly conserved

576Amostly conserved

585Cvariable

588Tmostly conserved

594Tmostly conserved

624Amostly conserved

633Cmostly conserved

645Tvariable

ACATTATATTTTATTTTTGGAGTTTGATCTGGAATAGTAGGAACATCATTAAGAGTACTAATTCGTGCTGAATTAAGTCATCCAGGTATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 67 variants.

Diversity (π)1.5%

Haplotypes67

BINs3

Most divergent pair6.7%

OceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes mariaesame genus7.6%Aedes caspiussame genus7.6%Aedes dorsalissame genus7.8%Aedes caballussame genus7.8%Aedes nigrithoraxsame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

08Occurrence & distribution

Record type1 942 records

Wild obs. + sensor512

Museum / vouchered1 430

Range

Area of Occupancy AOO2 052 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 288≤1 km 41≤10 km 6>10 km 100

435 georeferenced · 77 without coordinates

Open the mapobservation + sensor512

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤1 km 1≤10 km 13>10 km 34

48 georeferenced · 1 382 without coordinates

Open the institutions mapphysical evidence1 430

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Queensland Insect Collectionlocation not on record	910
Natick, US	452
San Francisco, US	32
Sydney, AU	27
Research Collection of Graeme V. Cockslocation not on record	2
Washington, US	2
Australian National Fish Collectionlocation not on record	2
Museums Victorialocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

9 institutions · 1 429 of 1 430 vouchered records shown · 1 without an institution code

09Environmental DNA185 detections

Where the DNA of Aedes vigilax was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found185

Studies independent surveys3

Countries3

Verifiable raw sequence linked17

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 185 detections have coordinates

Open the map3 countries0

UrbanroadsideDry Sclerophyll Forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 17.8–27.6

Seasonal swing summer↔winter7.90 °C

Max temp (day)24.9 °C 21.0–31.7

Min temp (night)22.1 °C 14.5–25.0

Precipitation99.2 mm/mo 23.7–270

Air humidity59.9 % 56.8–62.0

Moisture balance-45.9 mm/mo

Vapour deficit1,096 Pa 822–1,500

Wind speed3.50 m/s

Cloud cover31.0 % 16.9–51.9

CHELSA 1981–2010, ~9 km grid, at location & month of 121 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes vigilax

At a glance

Sources6 archives

At a glance

Record type1 942 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 942 records