Aedes sierrensis

(Ludlow, 1905) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records749

Data sources7

Biological traits0

DNA specimens112

eDNA detections150

Sources7 archives

Databases and archives Aedes sierrensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility749 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI150 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics112 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF749 records

Environmental DNA1 datasets · 2 countries150 detections

DNA & barcodingBOLD112 specimens

Genome at a glanceGoaT · NCBI≈1.2 Gbp

01Narrative

Jarnellius sierrensis is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1905 door Ludlow.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding112 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes sierrensis has left across the world's sequence archives.

At a glance

DNA specimens112

BINs3

Marker genes1

eDNA detections150

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus101 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

202Cmostly conserved

206Tmostly conserved

274Tmostly conserved

343Tvariable

466Amostly conserved

490Cmostly conserved

562Cmostly conserved

571Tmostly conserved

TACATTATATTTTATTTTTGGAATTTGATCCGGAATAATTGGAACATCATTAAGAATTTTAATTCGTACTGAATTAAGACATCCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.53%

Haplotypes14

BINs2

Most divergent pair11.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes monticolasame genus5.3%Aedes deserticolasame genus5.6%Aedes varipalpussame genus5.8%Aedes dorsalissame genus7.1%Aedes caballussame genus7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aedes sierrensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 183 456 917 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aedes sierrensis1.18 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type749 records

Wild obs. + sensor283

Museum / vouchered466

Range

Area of Occupancy AOO1 060 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 90≤1 km 15≤10 km 6>10 km 7

118 georeferenced · 165 without coordinates

Open the mapobservation + sensor283

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 334≤1 km 10≤10 km 52>10 km 11

407 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence466

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	356
San Francisco, US	73
Vancouver, CA	27
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Mosquitolocation not on record	2
National Ecological Observatory Network, United Stateslocation not on record	2
NEON Biorepository at Arizona State Universitylocation not on record	1

7 institutions · 466 of 466 vouchered records shown

09Environmental DNA150 detections

Where the DNA of Aedes sierrensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found150

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 150 detections have coordinates

Open the map2 countries0

grasslandHerbaceousevergreenForestWetlandForestshrubScrub

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 7.70–17.2

Seasonal swing summer↔winter15.7 °C

Max temp (day)16.2 °C 12.7–25.0

Min temp (night)11.1 °C 3.40–12.4

Precipitation63.0 mm/mo 22.0–242

Air humidity60.3 % 50.0–65.8

Moisture balance-75.5 mm/mo -127–168

Vapour deficit634 Pa 442–857

Wind speed1.90 m/s 1.10–3.60

Cloud cover40.7 % 27.6–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 132 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)