Aedes stimulans

(Walker, 1848) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records1 754

Data sources7

Biological traits0

DNA specimens78

eDNA detections0

Sources7 archives

Databases and archives Aedes stimulans's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 754 records↗

BOLD SystemsCentre for Biodiversity Genomics78 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 754 records

DNA & barcodingBOLD78 specimens

Genome at a glanceGoaT1.4 Gbp

01Narrative

Ochlerotatus stimulans is also known by the synonym 'Aedes stimulans' and the common name, woodland mosquito.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding78 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes stimulans has left across the world's sequence archives.

At a glance

DNA specimens78

BINs3

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus68 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 65 variable positions, in barcode order

1Tmostly conserved

29Gmostly conserved

49Cmostly conserved

50Cmostly conserved

80Gmostly conserved

81Tmostly conserved

82Cmostly conserved

118Cmostly conserved

187Tmostly conserved

193Cmostly conserved

202Cmostly conserved

205Tmostly conserved

206Tmostly conserved

217Gmostly conserved

220Cmostly conserved

232Cmostly conserved

235Tmostly conserved

238Tmostly conserved

278Cmostly conserved

283Amostly conserved

287Tmostly conserved

289Amostly conserved

292Cmostly conserved

295Amostly conserved

307Cmostly conserved

316Avariable

319Amostly conserved

322Gmostly conserved

334Tmostly conserved

337Amostly conserved

340Tmostly conserved

343Amostly conserved

346Amostly conserved

355Amostly conserved

361Tmostly conserved

367Tmostly conserved

370Tmostly conserved

376Cmostly conserved

379Amostly conserved

382Amostly conserved

397Cmostly conserved

412Tmostly conserved

415Tmostly conserved

421Cmostly conserved

433Gvariable

445Cmostly conserved

451Tmostly conserved

490Cmostly conserved

499Cmostly conserved

508Gmostly conserved

514Tmostly conserved

529Amostly conserved

530Amostly conserved

532Tmostly conserved

556Amostly conserved

574Tmostly conserved

586Amostly conserved

589Cmostly conserved

598Gmostly conserved

607Amostly conserved

625Amostly conserved

637Tmostly conserved

643Amostly conserved

646Cmostly conserved

652Cmostly conserved

TACATTATATTTTATTTTCGGAGTTTGAGCAGGAATAGTTGGAACATCCCTAAGAATTTTAATTCGTGCTGAATTAAGTGTCCCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes18

BINs3

Most divergent pair10.2%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes flavescenssame genus2.0%Aedes annulipessame genus2.1%Aedes euedessame genus3.6%Aedes ripariussame genus5.3%Aedes pullatussame genus8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Aedes stimulans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 408 320 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aedes stimulans1.41 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome records6–62n range6median6mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 62×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

08Occurrence & distribution

Record type1 754 records

Wild obs. + sensor1 101

Museum / vouchered653

Range

Area of Occupancy AOO872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 16≤1 km 1

17 georeferenced · 1 084 without coordinates

Open the mapobservation + sensor1 101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 81≤1 km 33≤10 km 292>10 km 63

469 georeferenced · 184 without coordinates

Open the institutions mapphysical evidence653

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	204
East Lansing, US	108
Tempe, US	74
Champaign, US	69
Ann Arbor, US	57
Saint John, CA	50
Chicago, US	30
San Francisco, US	17
UNHClocation not on record	12
National Ecological Observatory Network, United Stateslocation not on record	10
Wuzhou, CN	6
WIlocation not on record	5
Edmonton, CA	3
St. Paul, US	3
Biodiversity Institute of Ontariolocation not on record	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

17 institutions · 653 of 653 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes stimulans

At a glance

Sources7 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 754 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 17 geolocated

Record type1 754 records