Aedes riparius

Dyar & Knab, 1907 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records187

Data sources6

Biological traits0

DNA specimens46

eDNA detections50

Sources6 archives

Databases and archives Aedes riparius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility187 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics46 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF187 records

Environmental DNA1 datasets · 2 countries50 detections

DNA & barcodingBOLD46 specimens

01Narrative

Ochlerotatus riparius is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1907 door Dyar & Knab.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding46 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes riparius has left across the world's sequence archives.

At a glance

DNA specimens46

BINs3

Marker genes1

eDNA detections50

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P639 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 76 variable positions, in barcode order

10Gmostly conserved

21Tmostly conserved

30Amostly conserved

36Amostly conserved

48Tmostly conserved

51Tmostly conserved

61Gmostly conserved

62Tmostly conserved

63Cvariable

69Amostly conserved

87Cmostly conserved

99Tmostly conserved

114Cmostly conserved

120Amostly conserved

162Amostly conserved

168Cmostly conserved

174Cmostly conserved

183Tmostly conserved

201Cmostly conserved

213Cmostly conserved

246Amostly conserved

247Tmostly conserved

249Amostly conserved

252Tmostly conserved

255Amostly conserved

258Amostly conserved

259Cmostly conserved

264Amostly conserved

265Cmostly conserved

267Avariable

268Cmostly conserved

270Tmostly conserved

282Tmostly conserved

288Amostly conserved

297Avariable

309Gmostly conserved

318Tmostly conserved

324Cmostly conserved

327Amostly conserved

330Tmostly conserved

339Gmostly conserved

342Tmostly conserved

351Tmostly conserved

357Cmostly conserved

363Amostly conserved

378Tmostly conserved

381Cmostly conserved

393Tvariable

396Tmostly conserved

402Cmostly conserved

405Amostly conserved

414Amostly conserved

426Tmostly conserved

454Gmostly conserved

471Cmostly conserved

475Tmostly conserved

477Amostly conserved

480Cmostly conserved

481Cmostly conserved

495Tmostly conserved

510Amostly conserved

511Gmostly conserved

513Amostly conserved

522Tmostly conserved

534Tmostly conserved

543Cmostly conserved

559Tmostly conserved

562Tvariable

564Amostly conserved

570Tmostly conserved

591Tmostly conserved

597Cmostly conserved

622Cmostly conserved

624Amostly conserved

627Cmostly conserved

633Tmostly conserved

GGAGTTTGAGCAGGAATAGTTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTGTCCCAGGAATATTTATTGGAAATGACCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.4%

Haplotypes20

BINs3

Most divergent pair10.2%

N.AmericaEuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes euedessame genus4.7%Aedes cantanssame genus4.7%Aedes excrucianssame genus4.9%Aedes annulipessame genus5.2%Aedes flavescenssame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type187 records

Wild obs. + sensor10

Museum / vouchered177

Range

Area of Occupancy AOO236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 9 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 106≤1 km 32≤10 km 8>10 km 6

152 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence177

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	75
Edmonton, CA	69
National Ecological Observatory Network, United Stateslocation not on record	8
San Francisco, US	5
Vancouver, CA	4
UNHClocation not on record	4
CUlocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
University of Alberta Museums (UAM)location not on record	2
NARlocation not on record	1
Mohonk Preserve, Inc.location not on record	1
Provincia di Ascoli Picenolocation not on record	1

12 institutions · 175 of 177 vouchered records shown · 2 without an institution code

09Environmental DNA50 detections

Where the DNA of Aedes riparius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map2 countries0

GrasslandshrubScrubForestwoodyWetlandsmixedForestdeciduousForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 4.60–16.9

Seasonal swing summer↔winter35.9 °C

Max temp (day)19.6 °C 9.20–22.6

Min temp (night)10.7 °C 1.40–12.2

Precipitation71.4 mm/mo 56.7–89.5

Air humidity55.4 % 54.5–61.3

Moisture balance-41.4 mm/mo -52.6–5.90

Vapour deficit802 Pa 425–855

Wind speed2.10 m/s 1.70–3.20

Cloud cover44.8 % 41.1–57.2

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)