Aedes excrucians

(Walker, 1856) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records3 813

Data sources7

Biological traits0

DNA specimens448

eDNA detections5

Sources7 archives

Databases and archives Aedes excrucians's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 813 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics448 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 813 records

Environmental DNA1 datasets · 3 countries5 detections

DNA & barcodingBOLD448 specimens

Genome at a glanceGoaT2n = 6

01Narrative

Aedes excrucians is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1856 door Francis Walker.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding448 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes excrucians has left across the world's sequence archives.

At a glance

DNA specimens448

BINs4

Marker genes1

eDNA detections5

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus443 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

16Tvariable

100Amostly conserved

154Cmostly conserved

217Avariable

220Cmostly conserved

280Gmostly conserved

316Amostly conserved

340Tmostly conserved

355Amostly conserved

385Tmostly conserved

386Tmostly conserved

433Gvariable

445Cmostly conserved

508Gvariable

550Amostly conserved

562Amostly conserved

578Cmostly conserved

616Tvariable

619Amostly conserved

628Amostly conserved

634Cmostly conserved

646Cmostly conserved

TACATTATATTTTATTTTCGGAGTTTGAGCAGGAATAGTTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTGTCCCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 33 commonest of 125 variants.

Diversity (π)1.4%

Haplotypes125

BINs4

Most divergent pair10.3%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes annulipessame genus1.6%Aedes flavescenssame genus1.8%Aedes euedessame genus2.8%Aedes ripariussame genus4.9%Aedes intrudenssame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Aedes excrucians carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 61×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type3 813 records

Wild obs. + sensor863

Museum / vouchered2 950

Range

Area of Occupancy AOO1 940 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 176≤1 km 6≤10 km 10

192 georeferenced · 671 without coordinates

Open the mapobservation + sensor863

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 1 457≤1 km 491≤10 km 453>10 km 60

2 461 georeferenced · 489 without coordinates

Open the institutions mapphysical evidence2 950

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	1 215
Edmonton, CA	1 078
New Haven, US	185
Saint John, CA	148
University of Guelph, Centre for Biodiversity Genomicslocation not on record	116
Vancouver, CA	75
Ann Arbor, US	43
UNHClocation not on record	23
San Francisco, US	13
Champaign, US	11
St. Paul, US	4
Washington, US	4
Wuzhou, CN	3
University of Guelphlocation not on record	3
University of Alberta Museums (UAM)location not on record	2
Chicago, US	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
University Park, US	1
NARlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
CUlocation not on record	1
Mohonk Preserve, Inc.location not on record	1
National Ecological Observatory Network, United Stateslocation not on record	1
Toronto, CA	1
MZLUlocation not on record	1
WIlocation not on record	1
BMNHlocation not on record	1

27 institutions · 2 936 of 2 950 vouchered records shown · 13 without an institution code

09Environmental DNA5 detections

Where the DNA of Aedes excrucians was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map3 countries0

deciduousForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.2 °C 8.70–14.4

Seasonal swing summer↔winter35.9 °C

Max temp (day)14.2 °C 12.4–18.5

Min temp (night)7.00 °C 5.10–9.90

Precipitation72.6 mm/mo 61.0–84.9

Air humidity62.6 % 56.1–63.7

Moisture balance-15.7 mm/mo -36.3–-6.40

Vapour deficit466 Pa 452–735

Wind speed3.50 m/s 2.00–3.70

Cloud cover44.2 % 42.4–53.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes excrucians

At a glance

Sources7 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 813 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 813 records