Aedes annulipes

(Meigen, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records793

Data sources7

Biological traits2

DNA specimens91

eDNA detections1

Sources7 archives

Databases and archives Aedes annulipes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility793 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics91 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF793 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD91 specimens

01Narrative

Aedes annulipes (Synonym Ochlerotatus annulipes) ist ein Zweiflügler aus der Familie der Stechmücken (Culicidae). Innerhalb der Sammelgattung Aedes wird Aedes annulipes in die Untergattung Ochlerotatus gestellt.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)saprophagous

05DNA & barcoding91 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes annulipes has left across the world's sequence archives.

At a glance

DNA specimens91

BINs1

Marker genes2

eDNA detections1

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P611 bp consensus90 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

38Amostly conserved

41Tmostly conserved

89Tvariable

167Gvariable

170Gmostly conserved

173Tmostly conserved

212Cmostly conserved

281Amostly conserved

386Gmostly conserved

452Cmostly conserved

494Tmostly conserved

501Tmostly conserved

515Gvariable

CATTAAGAATTTTAATTCGTGCTGAATTAAGTGTCCCAGGTATATTTATTGGAAATGACCAAATTTATAACGTAATTGTTACAGCTCATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.62%

Haplotypes13

BIN1

Most divergent pair2.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes excrucianssame genus1.6%Aedes stimulanssame genus2.1%Aedes flavescenssame genus2.5%Aedes euedessame genus3.4%Aedes ripariussame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type793 records

Wild obs. + sensor732

Museum / vouchered61

Range

Area of Occupancy AOO1 648 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 232≤1 km 76≤10 km 226

534 georeferenced · 198 without coordinates

Open the mapobservation + sensor732

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 15

21 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	40
NCMGlocation not on record	5
DFFW2018location not on record	2
SLU Artdatabankenlocation not on record	2
SGAV-and-NHMDlocation not on record	1
DFFW1981location not on record	1
ITGlocation not on record	1
RKlocation not on record	1
Provincia di Ascoli Picenolocation not on record	1

9 institutions · 54 of 61 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Aedes annulipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median3.50 °C 3.50–3.50

Seasonal swing summer↔winter23.1 °C

Max temp (day)6.80 °C

Min temp (night)-0.1 °C

Precipitation61.7 mm/mo

Air humidity63.5 %

Moisture balance17.8 mm/mo

Vapour deficit351 Pa

Wind speed2.40 m/s

Cloud cover51.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)