Aedes cantans

(Meigen, 1818) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records977

Data sources7

Biological traits2

DNA specimens152

eDNA detections1

Sources7 archives

Databases and archives Aedes cantans's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility977 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics152 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF977 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD152 specimens

01Narrative

Aedes cantans (Synonym Ochlerotatus cantans) ist ein Zweiflügler aus der Familie der Stechmücken (Culicidae). Innerhalb der Sammelgattung Aedes wird Aedes cantans in die Untergattung Ochlerotatus gestellt.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)saprophagous

05DNA & barcoding152 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes cantans has left across the world's sequence archives.

At a glance

DNA specimens152

BINs1

Marker genes4

eDNA detections1

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P611 bp consensus149 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

41Amostly conserved

119Avariable

170Gmostly conserved

212Tmostly conserved

281Amostly conserved

293Tmostly conserved

296Amostly conserved

308Amostly conserved

386Amostly conserved

452Cmostly conserved

494Tmostly conserved

515Amostly conserved

572Amostly conserved

CATTAAGAATTTTAATTCGTGCTGAATTAAGTGTCCCAGGAATATTTATTGGAAATGACCAAATTTATAACGTAATTGTTACAGCTCATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.70%

Haplotypes23

BIN1

Most divergent pair2.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes euedessame genus3.3%Aedes ripariussame genus4.7%Aedes squamigersame genus7.7%Aedes pullatussame genus7.7%Aedes ventrovittissame genus8.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS216S

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type977 records

Wild obs. + sensor833

Museum / vouchered144

Range

Area of Occupancy AOO1 988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 238≤1 km 73≤10 km 245

556 georeferenced · 277 without coordinates

Open the mapobservation + sensor833

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 24≤1 km 15≤10 km 15

54 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence144

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	96
Animal and Plant Health Agency, UKlocation not on record	8
NCMGlocation not on record	4
ITGlocation not on record	2
SLU Artdatabankenlocation not on record	2
Ugentlocation not on record	2
SGAV-and-NHMDlocation not on record	1
DFFW2018location not on record	1
Provincia di Ascoli Picenolocation not on record	1
Mohonk Preserve, Inc.location not on record	1

10 institutions · 118 of 144 vouchered records shown · 26 without an institution code

09Environmental DNA1 detections

Where the DNA of Aedes cantans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)