Aedes rusticus

(Rossi, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records2 233

Data sources5

Biological traits2

DNA specimens74

eDNA detections118

Sources5 archives

Databases and archives Aedes rusticus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 233 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI118 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics74 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 233 records

Environmental DNA4 datasets · 8 countries118 detections

DNA & barcodingBOLD74 specimens

01Narrative

Ochlerotatus rusticus is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1790 door Rossi.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)saprophagous

05DNA & barcoding74 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes rusticus has left across the world's sequence archives.

At a glance

DNA specimens74

BINs3

Marker genes4

eDNA detections118

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus63 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

19Tmostly conserved

22Gmostly conserved

34Amostly conserved

46Gmostly conserved

121Gmostly conserved

266Cmostly conserved

274Cmostly conserved

316Amostly conserved

367Cmostly conserved

415Amostly conserved

418Amostly conserved

433Gmostly conserved

581Cmostly conserved

634Cmostly conserved

AACATTATATTTCATTTTTGGGGTATGATCAGGAATAGTAGGAACGTCATTAAGTATACTAATTCGTGCTGAATTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.86%

Haplotypes13

BINs3

Most divergent pair2.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes refikisame genus4.6%Aedes provocanssame genus4.7%Aedes nigrithoraxsame genus6.5%Aedes vittigersame genus6.7%Aedes cantatorsame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS216S

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type2 233 records

Wild obs. + sensor2 197

Museum / vouchered36

Range

Area of Occupancy AOO1 652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy11% within 1 km

≤100 m 182≤1 km 28≤10 km 1 760

1 970 georeferenced · 227 without coordinates

Open the mapobservation + sensor2 197

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 3≤1 km 10≤10 km 4

17 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	10
NCMGlocation not on record	8
Animal and Plant Health Agency, UKlocation not on record	5
Ugentlocation not on record	2
DFFW1981location not on record	1
VPlocation not on record	1
SLU Artdatabankenlocation not on record	1
University of Primorskalocation not on record	1
SPblocation not on record	1

9 institutions · 30 of 36 vouchered records shown · 5 without an institution code

09Environmental DNA118 detections

Where the DNA of Aedes rusticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found118

Studies independent surveys4

Countries8

Verifiable raw sequence linked26

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 118 detections have coordinates

Open the map8 countries0

Cattle farmMixed WoodlandGrazing marsh

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 9.50–15.1

Seasonal swing summer↔winter15.9 °C

Max temp (day)17.9 °C 12.9–18.9

Min temp (night)11.4 °C 5.80–12.2

Precipitation51.3 mm/mo 40.7–70.7

Air humidity61.1 % 58.8–63.5

Moisture balance-67.3 mm/mo -88.5–-1.10

Vapour deficit648 Pa 452–684

Wind speed3.90 m/s 2.90–5.30

Cloud cover40.4 % 38.6–44.1

CHELSA 1981–2010, ~9 km grid, at location & month of 98 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes rusticus

At a glance

Sources5 archives

Diet & foraging2

At a glance

Record type2 233 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 233 records