Aedes vittiger

(Skuse, 1889) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records644

Data sources5

Biological traits0

DNA specimens24

eDNA detections38

Sources5 archives

Databases and archives Aedes vittiger's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility644 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF644 records

Environmental DNA1 datasets · 1 countries38 detections

DNA & barcodingBOLD24 specimens

01Narrative

Ochlerotatus vittiger is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1889 door Skuse.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes vittiger has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes2

eDNA detections38

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P667 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

1Amostly conserved

22Gvariable

337Tmostly conserved

340Tmostly conserved

415Gmostly conserved

641Cvariable

664Cmostly conserved

AACATTATATTTTATTTTCGGGGTTTGATCGGGAATAGTAGGAACATCATTAAGTATTTTAATTCGTGCTGAATTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes3

BIN1

Most divergent pair0.60%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes nigrithoraxsame genus1.7%Aedes sagaxsame genus2.3%Aedes dorsalissame genus5.3%Aedes provocanssame genus5.5%Aedes refikisame genus5.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type644 records

Wild obs. + sensor337

Museum / vouchered307

Range

Area of Occupancy AOO1 360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 154≤1 km 54≤10 km 13>10 km 45

266 georeferenced · 71 without coordinates

Open the mapobservation + sensor337

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 4≤10 km 14>10 km 1

19 georeferenced · 288 without coordinates

Open the institutions mapphysical evidence307

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Queensland Insect Collectionlocation not on record	274
Sydney, AU	14
Museums Victorialocation not on record	13
Australian National Fish Collectionlocation not on record	4
Centre for Biodiversity Genomicslocation not on record	1
DPIlocation not on record	1

6 institutions · 307 of 307 vouchered records shown

09Environmental DNA38 detections

Where the DNA of Aedes vittiger was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map1 country0

open forestroadside

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 17.9–22.0

Seasonal swing summer↔winter10.1 °C

Max temp (day)25.8 °C 21.3–28.0

Min temp (night)15.5 °C 13.2–17.7

Precipitation29.6 mm/mo 23.7–72.2

Air humidity55.2 % 47.8–59.0

Moisture balance-86.4 mm/mo -174–-55.4

Vapour deficit1,066 Pa 896–1,374

Wind speed3.70 m/s 2.30–4.40

Cloud cover21.4 % 15.4–30.1

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)