Aedes provocans

(Walker, 1848) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records1 116

Data sources5

Biological traits0

DNA specimens197

eDNA detections196

Sources5 archives

Databases and archives Aedes provocans's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 116 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI196 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics197 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 116 records

Environmental DNA1 datasets · 3 countries196 detections

DNA & barcodingBOLD197 specimens

01Narrative

Ochlerotatus provocans is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1848 door Walker.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding197 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes provocans has left across the world's sequence archives.

At a glance

DNA specimens197

BINs1

Marker genes1

eDNA detections196

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus186 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

40Amostly conserved

274Amostly conserved

412Amostly conserved

628Amostly conserved

631Gmostly conserved

AACATTATATTTTATTTTCGGAGTATGATCGGGAATAGTAGGTACATCATTAAGTATATTAATTCGTGCTGAATTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 66 variants.

Diversity (π)0.38%

Haplotypes66

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes refikisame genus3.2%Aedes rusticussame genus4.7%Aedes vittigersame genus5.5%Aedes nigrithoraxsame genus5.8%Aedes sagaxsame genus6.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 116 records

Wild obs. + sensor201

Museum / vouchered915

Range

Area of Occupancy AOO580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 169≤1 km 2≤10 km 1>10 km 2

174 georeferenced · 27 without coordinates

Open the mapobservation + sensor201

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 643≤1 km 2≤10 km 50

695 georeferenced · 220 without coordinates

Open the institutions mapphysical evidence915

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	705
Saint John, CA	109
University of Guelph, Centre for Biodiversity Genomicslocation not on record	37
UNHClocation not on record	33
New Haven, US	19
Vancouver, CA	5
University of Alberta Museums (UAM)location not on record	2
NEON Biorepository at Arizona State Universitylocation not on record	2
University of Guelphlocation not on record	2
St. Paul, US	1

10 institutions · 915 of 915 vouchered records shown

09Environmental DNA196 detections

Where the DNA of Aedes provocans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found196

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 196 detections have coordinates

Open the map3 countries0

Temperate mixed forestMixed habitatGrasslandmixedForestdeciduousForestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 6.80–18.2

Seasonal swing summer↔winter28.8 °C

Max temp (day)18.6 °C 12.2–23.1

Min temp (night)8.40 °C 1.70–14.2

Precipitation89.8 mm/mo 78.2–108

Air humidity57.5 % 54.9–59.9

Moisture balance-34.1 mm/mo -43.4–1.00

Vapour deficit667 Pa 448–861

Wind speed3.10 m/s 2.30–3.90

Cloud cover45.2 % 41.9–48.7

CHELSA 1981–2010, ~9 km grid, at location & month of 185 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes provocans

At a glance

Sources5 archives

At a glance

Record type1 116 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 116 records