Aedes fitchii

(Felt & Young, 1904) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records2 733

Data sources6

Biological traits0

DNA specimens295

eDNA detections35

Sources6 archives

Databases and archives Aedes fitchii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 733 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics295 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 733 records

Environmental DNA1 datasets · 2 countries35 detections

DNA & barcodingBOLD295 specimens

01Narrative

Ochlerotatus fitchii is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1904 door Felt & Young.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding295 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes fitchii has left across the world's sequence archives.

At a glance

DNA specimens295

BINs10

Marker genes1

eDNA detections35

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus284 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 75 variable positions, in barcode order

1Amostly conserved

10Cvariable

16Tmostly conserved

29Tmostly conserved

31Cmostly conserved

34Gvariable

43Gvariable

49Tvariable

58Tmostly conserved

67Amostly conserved

80Cmostly conserved

81Amostly conserved

82Amostly conserved

94Cmostly conserved

100Amostly conserved

106Tmostly conserved

154Tmostly conserved

166Amostly conserved

193Tmostly conserved

202Tmostly conserved

206Cmostly conserved

217Gvariable

220Amostly conserved

229Amostly conserved

271Avariable

278Tmostly conserved

280Gmostly conserved

283Gvariable

284Cmostly conserved

286Gmostly conserved

287Cmostly conserved

289Amostly conserved

292Tmostly conserved

295Gmostly conserved

301Tmostly conserved

307Amostly conserved

316Tmostly conserved

322Amostly conserved

334Amostly conserved

337Tmostly conserved

340Tmostly conserved

343Tmostly conserved

346Tmostly conserved

352Tmostly conserved

355Tmostly conserved

373Amostly conserved

376Tmostly conserved

382Tmostly conserved

391Tmostly conserved

397Tmostly conserved

412Cmostly conserved

415Amostly conserved

418Amostly conserved

421Tmostly conserved

433Amostly conserved

436Tmostly conserved

445Tmostly conserved

466Amostly conserved

473Tmostly conserved

490Tmostly conserved

494Tmostly conserved

499Tmostly conserved

508Amostly conserved

529Tmostly conserved

547Tvariable

550Amostly conserved

562Tmostly conserved

565Gvariable

578Tmostly conserved

616Cmostly conserved

619Tmostly conserved

634Cmostly conserved

646Cmostly conserved

652Tmostly conserved

658Cmostly conserved

AACATTATACTTTATTTTCGGAGTTTGATCCGGGATAGTTGGGACATCTTTAAGAATTTTAATTCGAGCTGAATTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 89 variants.

Diversity (π)4.2%

Haplotypes89

BINs10

Most divergent pair12.3%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes melanimonsame genus6.4%Aedes ventrovittissame genus6.5%Aedes antipodeussame genus7.0%Aedes camptorhynchussame genus7.1%Aedes infirmatussame genus7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 733 records

Wild obs. + sensor733

Museum / vouchered2 000

Range

Area of Occupancy AOO1 616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 37

37 georeferenced · 696 without coordinates

Open the mapobservation + sensor733

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 1 143≤1 km 115≤10 km 375>10 km 64

1 697 georeferenced · 303 without coordinates

Open the institutions mapphysical evidence2 000

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	897
Edmonton, CA	607
Vancouver, CA	101
Saint John, CA	95
New Haven, US	87
Wuzhou, CN	66
San Francisco, US	49
UNHClocation not on record	36
Champaign, US	24
Chicago, US	11
National Ecological Observatory Network, United Stateslocation not on record	10
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
NEON Biorepository at Arizona State Universitylocation not on record	4
University of Alberta Museums (UAM)location not on record	2
WIlocation not on record	2
Mosquitolocation not on record	1
Bronx, US	1
Ann Arbor, US	1
St. Paul, US	1

19 institutions · 2 000 of 2 000 vouchered records shown

09Environmental DNA35 detections

Where the DNA of Aedes fitchii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map2 countries0

evergreenForest1. Forest & WoodlanddeciduousForestwoodyWetlandsForestmixedForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 8.40–18.5

Seasonal swing summer↔winter17.8 °C

Max temp (day)20.7 °C 13.1–24.6

Min temp (night)10.9 °C 4.10–15.5

Precipitation86.6 mm/mo 22.0–218

Air humidity59.2 % 57.3–63.0

Moisture balance-41.4 mm/mo -127–132

Vapour deficit741 Pa 462–870

Wind speed2.00 m/s 1.70–4.00

Cloud cover38.6 % 29.2–42.7

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes fitchii

At a glance

Sources6 archives

At a glance

Record type2 733 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 733 records