Aedes epactius

Dyar & Knab, 1908 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records886

Data sources6

Biological traits0

DNA specimens38

eDNA detections28

Sources6 archives

Databases and archives Aedes epactius's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility886 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF886 records

Environmental DNA1 datasets · 3 countries28 detections

DNA & barcodingBOLD38 specimens

01Narrative

Aedes epactius is a species of mosquito (Culicidae) native to North America. Some mosquitoes in North America, such as Aedes albopictus and Aedes aegypti have a similar scutellum pattern.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes epactius has left across the world's sequence archives.

At a glance

DNA specimens38

BINs3

Marker genes1

eDNA detections28

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

43Amostly conserved

88Amostly conserved

118Tmostly conserved

133Tmostly conserved

172Tmostly conserved

181Amostly conserved

205Tmostly conserved

217Amostly conserved

220Cmostly conserved

250Tmostly conserved

271Tmostly conserved

319Gvariable

322Gmostly conserved

325Cmostly conserved

328Amostly conserved

346Tmostly conserved

358Amostly conserved

364Tvariable

415Avariable

475Amostly conserved

499Tmostly conserved

505Tmostly conserved

508Cmostly conserved

538Tmostly conserved

565Amostly conserved

589Cmostly conserved

607Amostly conserved

631Amostly conserved

AACTTTATATTTTATTTTTGGGGTTTGATCCGGAATAGTAGGAACATCCCTAAGAATTTTAATTCGAGCAGAATTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes14

BINs3

Most divergent pair3.2%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes atropalpussame genus7.8%Aedes canadensissame genus8.8%Aedes turnerisame genus9.0%Aedes ventrovittissame genus9.1%Aedes atlanticussame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type886 records

Wild obs. + sensor490

Museum / vouchered396

Range

Area of Occupancy AOO764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 24≤1 km 4≤10 km 5>10 km 7

40 georeferenced · 450 without coordinates

Open the mapobservation + sensor490

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 198≤1 km 5≤10 km 1

204 georeferenced · 192 without coordinates

Open the institutions mapphysical evidence396

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	188
San Nicolás de los Garza, MX	187
Tempe, US	17
Universidad Autonoma Agraria Antonio Narro, Unidad Lagunalocation not on record	2
National Ecological Observatory Network, United Stateslocation not on record	2

5 institutions · 396 of 396 vouchered records shown

09Environmental DNA28 detections

Where the DNA of Aedes epactius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map3 countries0

shrubScrub

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.9 °C 16.2–26.7

Seasonal swing summer↔winter5.20 °C

Max temp (day)24.6 °C 19.9–31.1

Min temp (night)15.7 °C 11.9–20.7

Precipitation223 mm/mo 135–504

Air humidity62.6 % 54.7–65.4

Moisture balance85.6 mm/mo -12.8–372

Vapour deficit918 Pa 633–1,569

Wind speed1.00 m/s 0.8–1.80

Cloud cover29.0 % 22.6–32.8

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)