Aedes atlanticus

Dyar & Knab, 1906 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records12 482

Data sources7

Biological traits0

DNA specimens234

eDNA detections246

Sources7 archives

Databases and archives Aedes atlanticus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 482 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI246 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics234 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF12 482 records

Environmental DNA1 datasets · 1 countries246 detections

DNA & barcodingBOLD234 specimens

01Narrative

Aedes atlanticus is a species of Aedes mosquito native to the southeastern United States of America. It is known for carrying a number of pathogens that can infect humans, most notably yellow fever.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding234 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes atlanticus has left across the world's sequence archives.

At a glance

DNA specimens234

BINs4

Marker genes1

eDNA detections246

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus232 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

19Cmostly conserved

85Tvariable

100Avariable

136Tvariable

206Tvariable

223Avariable

283Tvariable

313Tmostly conserved

316Avariable

331Avariable

364Cvariable

397Tvariable

433Gvariable

451Tvariable

457Tvariable

485Cvariable

487Avariable

490Cvariable

508Avariable

517Tvariable

547Tvariable

586Tvariable

589Cvariable

595Tvariable

616Tmostly conserved

634Cmostly conserved

637Tvariable

646Tmostly conserved

658Cmostly conserved

AACTTTATATTTCATCTTCGGAGTTTGATCAGGAATAGTTGGTACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCATCCTGGTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 139 variants.

Diversity (π)2.3%

Haplotypes139

BINs4

Most divergent pair11.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes tormentorsame genus1.5%Aedes serratussame genus2.7%Aedes pertinaxsame genus2.9%Aedes dupreeisame genus4.0%Aedes dentatussame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type12 482 records

Wild obs. + sensor11 171

Museum / vouchered1 311

Range

Area of Occupancy AOO2 068 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 42≤1 km 13≤10 km 5>10 km 26

86 georeferenced · 11 085 without coordinates

Open the mapobservation + sensor11 171

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 1 049≤1 km 1≤10 km 41>10 km 15

1 106 georeferenced · 205 without coordinates

Open the institutions mapphysical evidence1 311

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	1 147
Ann Arbor, US	37
Chicago, US	32
New Haven, US	27
Champaign, US	27
San Francisco, US	14
Cambridge, US	6
Edmonton, CA	5
Denver, US	4
Wuzhou, CN	4
UNHClocation not on record	4
CUlocation not on record	2
National Ecological Observatory Network, United Stateslocation not on record	1
University of Central Floridalocation not on record	1

14 institutions · 1 311 of 1 311 vouchered records shown

09Environmental DNA246 detections

Where the DNA of Aedes atlanticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found246

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 246 detections have coordinates

Open the map1 country0

evergreenForestdeciduousForestwoodyWetlandsmixedForestemergentHerbaceousWetlands

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 13.9–27.2

Seasonal swing summer↔winter19.7 °C

Max temp (day)28.9 °C 17.5–32.5

Min temp (night)18.8 °C 10.5–23.2

Precipitation112 mm/mo 92.4–182

Air humidity59.2 % 57.2–62.6

Moisture balance-10.3 mm/mo -53.3–36.3

Vapour deficit1,213 Pa 747–1,422

Wind speed2.40 m/s 1.50–4.20

Cloud cover33.7 % 28.0–42.3

CHELSA 1981–2010, ~9 km grid, at location & month of 243 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes atlanticus

At a glance

Sources7 archives

At a glance

Record type12 482 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type12 482 records