Aedes serratus

(Theobald, 1901) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records788

Data sources6

Biological traits0

DNA specimens72

eDNA detections4

Sources6 archives

Databases and archives Aedes serratus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility788 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics72 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF788 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD72 specimens

01Narrative

Ochlerotatus serratus is a species of mosquito.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding72 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes serratus has left across the world's sequence archives.

At a glance

DNA specimens72

BINs2

Marker genes2

eDNA detections4

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus45 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 32 variable positions, in barcode order

10Tvariable

37Amostly conserved

45Cmostly conserved

46Amostly conserved

53Amostly conserved

57Tmostly conserved

78Gmostly conserved

100Amostly conserved

328Amostly conserved

340Tmostly conserved

343Tmostly conserved

364Tmostly conserved

385Tmostly conserved

400Tvariable

406Tmostly conserved

409Amostly conserved

433Gvariable

457Avariable

472Amostly conserved

478Amostly conserved

484Tvariable

490Cmostly conserved

499Tvariable

500Cvariable

508Avariable

548Cvariable

578Cvariable

595Cvariable

596Tmostly conserved

613Tvariable

634Cvariable

646Cvariable

AACTTTATATTTCATCTTCGGAGTTTGATCAGGAATAGTTGGTACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCATCCCGGTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes27

BINs2

Most divergent pair3.3%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes atlanticussame genus2.7%Aedes tormentorsame genus3.1%Aedes dupreeisame genus4.4%Aedes infirmatussame genus7.1%Aedes thelctersame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type788 records

Wild obs. + sensor18

Museum / vouchered770

Range

Area of Occupancy AOO596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1≤1 km 1>10 km 6

8 georeferenced · 10 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 69≤1 km 29≤10 km 62>10 km 10

170 georeferenced · 600 without coordinates

Open the institutions mapphysical evidence770

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	324
UFPRlocation not on record	212
The University of the West Indies, Trinidad and Tobagolocation not on record	91
Ciudad de México, MX	60
EcoFoGlocation not on record	22
Institut Pasteur de la Guyanelocation not on record	18
New Haven, US	10
San Nicolás de los Garza, MX	9
Museo de Zoología, Universidad San Francisco de Quitolocation not on record	7
UMR Ecologie des Forets de Guyanelocation not on record	4
El Colegio de la Frontera Sur, Unidad Chetumallocation not on record	3
Animal and Plant Health Agency, UKlocation not on record	3
University of Queensland Insect Collectionlocation not on record	3
Naturalis Biodiversity Centerlocation not on record	1
Fundação Oswaldo Cruzlocation not on record	1
Instituto de Medicina Tropical Pedro Kourílocation not on record	1
Instituto Nacional de Biodiversidad (INBio)location not on record	1

17 institutions · 770 of 770 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Aedes serratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 24.0–25.2

Seasonal swing summer↔winter5.70 °C

Max temp (day)28.6 °C 27.4–28.6

Min temp (night)21.2 °C 20.7–21.2

Precipitation379 mm/mo 160–379

Air humidity65.0 % 64.0–65.0

Moisture balance217 mm/mo 43.6–217

Vapour deficit1,115 Pa 1,071–1,115

Wind speed0.7 m/s 0.7–1.50

Cloud cover26.2 % 26.2–30.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)