Aedes atropalpus

(Coquillett, 1902) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records383

Data sources7

Biological traits0

DNA specimens35

eDNA detections35

Sources7 archives

Databases and archives Aedes atropalpus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility383 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF383 records

Environmental DNA1 datasets · 2 countries35 detections

DNA & barcodingBOLD35 specimens

01Narrative

Aedes atropalpus, also known by its common name American rock pool mosquito is a species from the subgenus Georgecraigius. The species was originally described by Daniel William Coquillett in 1902

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes atropalpus has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes2

eDNA detections35

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P629 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

41Amostly conserved

59Tmostly conserved

80Amostly conserved

92Amostly conserved

155Amostly conserved

173Cmostly conserved

258Tvariable

329Tmostly conserved

344Amostly conserved

425Tmostly conserved

437Amostly conserved

446Amostly conserved

605Cmostly conserved

CCGGAATAATTGGAACATCTTTAAGAATTTTAATCCGAGCAGAATTAAGACAACCTGGTATATTTATTGGTAATGATCAAATTTATAACG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.60%

Haplotypes10

BIN1

Most divergent pair1.7%

N.AmericaOtherEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes epactiussame genus7.8%Aedes ventrovittissame genus8.4%Haemagogus capricorniisame family9.1%Haemagogus janthinomyssame family9.1%Aedes increpitussame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type383 records

Wild obs. + sensor123

Museum / vouchered260

Range

Area of Occupancy AOO420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 17≤1 km 1≤10 km 1>10 km 6

25 georeferenced · 98 without coordinates

Open the mapobservation + sensor123

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 5≤1 km 5≤10 km 39>10 km 18

67 georeferenced · 193 without coordinates

Open the institutions mapphysical evidence260

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mosquitolocation not on record	169
San Francisco, US	21
Natural History Museum of Utahlocation not on record	15
New Haven, US	14
University of Guelphlocation not on record	12
UNHClocation not on record	11
CUlocation not on record	7
San Nicolás de los Garza, MX	5
Saint John, CA	3
Wuzhou, CN	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

11 institutions · 259 of 260 vouchered records shown · 1 without an institution code

09Environmental DNA35 detections

Where the DNA of Aedes atropalpus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map2 countries0

ForestInvasive species

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 11.5–20.4

Seasonal swing summer↔winter34.2 °C

Max temp (day)17.1 °C 16.5–23.5

Min temp (night)9.20 °C 6.50–18.7

Precipitation77.9 mm/mo 77.6–86.5

Air humidity58.2 % 58.2–61.5

Moisture balance-35.8 mm/mo -83.7–-22.0

Vapour deficit575 Pa 566–960

Wind speed2.40 m/s 2.40–5.00

Cloud cover47.0 % 39.3–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)