Aedes albifasciatus

(Macquart, 1838) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records108

Data sources4

Biological traits0

DNA specimens111

eDNA detections111

Sources4 archives

Databases and archives Aedes albifasciatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility108 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI111 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics111 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF108 records

Environmental DNA1 datasets · 2 countries111 detections

DNA & barcodingBOLD111 specimens

01Narrative

Ochlerotatus albifasciatus is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1838 door Macquart.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding111 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes albifasciatus has left across the world's sequence archives.

At a glance

DNA specimens111

BINs1

Marker genes1

eDNA detections111

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus108 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

40Tmostly conserved

187Cvariable

265Gmostly conserved

286Gmostly conserved

292Cmostly conserved

316Avariable

328Amostly conserved

340Tmostly conserved

343Amostly conserved

361Tmostly conserved

373Amostly conserved

415Gvariable

499Tvariable

565Amostly conserved

628Avariable

634Cmostly conserved

646Cmostly conserved

AACTTTATACTTCATTTTTGGAGTTTGATCAGGAATAGTTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes15

BIN1

Most divergent pair2.0%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes spenceriisame genus5.6%Aedes sticticussame genus6.1%Aedes dorsalissame genus7.0%Aedes mariaesame genus7.1%Aedes melanimonsame genus7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type108 records

Wild obs. + sensor85

Museum / vouchered23

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 49≤1 km 14≤10 km 9

72 georeferenced · 13 without coordinates

Open the mapobservation + sensor85

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 23 records without

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	21
Universidad Nacional de Cordoba, Centro de Investigaciones Entomologicas de Cordobalocation not on record	1
Fundação Oswaldo Cruzlocation not on record	1

3 institutions · 23 of 23 vouchered records shown

09Environmental DNA111 detections

Where the DNA of Aedes albifasciatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found111

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 111 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.1 °C 14.1–23.1

Seasonal swing summer↔winter14.2 °C

Max temp (day)26.6 °C 19.5–28.8

Min temp (night)19.9 °C 9.90–19.9

Precipitation154 mm/mo 13.2–154

Air humidity60.2 % 55.7–60.3

Moisture balance10.8 mm/mo -68.9–10.8

Vapour deficit1,118 Pa 613–1,228

Wind speed3.40 m/s 3.40–3.90

Cloud cover38.8 % 32.7–38.8

CHELSA 1981–2010, ~9 km grid, at location & month of 110 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)