Aedes spencerii

(Theobald, 1901) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records578

Data sources4

Biological traits0

DNA specimens44

eDNA detections1 771

Sources4 archives

Databases and archives Aedes spencerii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility578 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 771 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF578 records

Environmental DNA1 datasets · 2 countries1 771 detections

DNA & barcodingBOLD44 specimens

01Narrative

Ochlerotatus spencerii is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1901 door Theobald.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes spencerii has left across the world's sequence archives.

At a glance

DNA specimens44

BINs4

Marker genes1

eDNA detections1 771

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 77 variable positions, in barcode order

1Amostly conserved

13Cmostly conserved

19Tmostly conserved

22Tmostly conserved

31Amostly conserved

40Amostly conserved

49Amostly conserved

79Tmostly conserved

88Amostly conserved

94Cvariable

100Amostly conserved

118Cmostly conserved

133Tmostly conserved

136Cmostly conserved

166Amostly conserved

202Tmostly conserved

208Amostly conserved

220Tmostly conserved

223Tmostly conserved

232Tmostly conserved

235Cmostly conserved

238Amostly conserved

259Tmostly conserved

266Tmostly conserved

268Amostly conserved

271Tvariable

277Amostly conserved

280Amostly conserved

283Amostly conserved

286Avariable

289Amostly conserved

292Cvariable

295Tmostly conserved

304Amostly conserved

307Amostly conserved

316Avariable

319Tmostly conserved

325Amostly conserved

334Amostly conserved

337Tmostly conserved

340Tmostly conserved

343Tvariable

352Amostly conserved

355Amostly conserved

364Tmostly conserved

370Tmostly conserved

373Tmostly conserved

412Tvariable

415Amostly conserved

416Gmostly conserved

418Tmostly conserved

421Amostly conserved

433Gvariable

451Amostly conserved

454Amostly conserved

457Amostly conserved

472Amostly conserved

473Gmostly conserved

484Tmostly conserved

490Cvariable

499Tmostly conserved

505Tmostly conserved

508Tmostly conserved

514Tmostly conserved

517Amostly conserved

520Amostly conserved

529Cvariable

550Amostly conserved

553Tmostly conserved

556Tmostly conserved

562Cvariable

583Amostly conserved

604Tmostly conserved

620Gvariable

628Amostly conserved

637Amostly conserved

646Cmostly conserved

AACATTATACTTCATTTTTGGTGTTTGATCAGGAATAGTAGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes25

BINs4

Most divergent pair9.7%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes sticticussame genus2.4%Aedes albifasciatussame genus5.6%Aedes ventrovittissame genus6.5%Aedes caballussame genus6.8%Aedes dorsalissame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type578 records

Wild obs. + sensor502

Museum / vouchered76

Range

Area of Occupancy AOO692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 501 without coordinates

Open the mapobservation + sensor502

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤100 m 4≤1 km 1≤10 km 48>10 km 19

72 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WIlocation not on record	32
San Francisco, US	26
UNHClocation not on record	8
Tempe, US	4
Vancouver, CA	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
New Haven, US	1
Champaign, US	1

8 institutions · 76 of 76 vouchered records shown

09Environmental DNA1 771 detections

Where the DNA of Aedes spencerii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 771

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 771 detections have coordinates

Open the map2 countries0

4. Native Grassland | 4.4. Temperate GrasslandRiparian ZoneevergreenForestgrasslandHerbaceouspastureHayAgricultural field

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 14.7–16.5

Seasonal swing summer↔winter25.6 °C

Max temp (day)21.1 °C 20.9–22.7

Min temp (night)8.80 °C 8.80–12.1

Precipitation69.8 mm/mo 69.8–108

Air humidity55.9 % 55.9–57.4

Moisture balance-59.3 mm/mo -59.3–-22.2

Vapour deficit736 Pa 736–811

Wind speed1.90 m/s 1.90–3.40

Cloud cover35.5 % 35.5–40.6

CHELSA 1981–2010, ~9 km grid, at location & month of 1 744 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)