Aedes sticticus

(Meigen, 1835) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Aedes

At a glance

Occurrence records9 758

Data sources7

Biological traits2

DNA specimens1 793

eDNA detections129

Sources7 archives

Databases and archives Aedes sticticus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 758 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI129 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 793 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF9 758 records

Environmental DNA4 datasets · 15 countries129 detections

DNA & barcodingBOLD1 793 specimens

01Narrative

Ochlerotatus sticticus (synonym Aedes sticticus) is an uncommon mosquito, although the species can be abundant along river floodlands. It has been known to be responsible for human bites. Like all mosquitoes, it is only the females that bite.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)saprophagous

05DNA & barcoding1 793 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aedes sticticus has left across the world's sequence archives.

At a glance

DNA specimens1 793

BINs8

Marker genes4

eDNA detections129

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus738 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 48 variable positions, in barcode order

10Cmostly conserved

13Cmostly conserved

22Tmostly conserved

31Avariable

40Amostly conserved

79Tmostly conserved

88Amostly conserved

100Avariable

118Cmostly conserved

136Cmostly conserved

181Avariable

184Gvariable

199Avariable

212Tmostly conserved

220Tmostly conserved

229Avariable

232Tmostly conserved

259Tmostly conserved

271Tmostly conserved

274Tmostly conserved

280Amostly conserved

316Amostly conserved

325Tmostly conserved

328Tvariable

343Tmostly conserved

352Tmostly conserved

364Cmostly conserved

370Tmostly conserved

373Tmostly conserved

379Amostly conserved

412Cmostly conserved

415Avariable

433Avariable

478Avariable

485Cmostly conserved

505Cmostly conserved

517Gmostly conserved

536Cmostly conserved

553Cvariable

556Tmostly conserved

562Cmostly conserved

586Tmostly conserved

589Cmostly conserved

607Amostly conserved

613Tmostly conserved

619Amostly conserved

625Gvariable

628Amostly conserved

AACATTATACTTCATTTTTGGTGTTTGATCAGGAATAGTAGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCAACCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 137 variants.

Diversity (π)3.3%

Haplotypes137

BINs8

Most divergent pair10.5%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aedes spenceriisame genus2.4%Aedes albifasciatussame genus6.1%Aedes ventrovittissame genus6.8%Aedes caballussame genus7.6%Aedes dorsalissame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS216S

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type9 758 records

Wild obs. + sensor7 024

Museum / vouchered2 734

Range

Area of Occupancy AOO3 920 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 89≤1 km 31≤10 km 142>10 km 4

266 georeferenced · 6 758 without coordinates

Open the mapobservation + sensor7 024

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 1 275≤1 km 49≤10 km 143>10 km 10

1 477 georeferenced · 1 257 without coordinates

Open the institutions mapphysical evidence2 734

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	1 336
University of Guelph, Centre for Biodiversity Genomicslocation not on record	957
Champaign, US	192
Chicago, US	36
Ann Arbor, US	26
San Francisco, US	23
UNHClocation not on record	20
Wuzhou, CN	20
WIlocation not on record	15
Saint John, CA	15
Vancouver, CA	14
New Haven, US	12
Edmonton, CA	11
CUlocation not on record	5
National Ecological Observatory Network, United Stateslocation not on record	5
Washington, US	4
NEON Biorepository at Arizona State Universitylocation not on record	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
University of Queensland Insect Collectionlocation not on record	2
SLU Artdatabankenlocation not on record	2
Provincia di Ascoli Picenolocation not on record	2
St. Paul, US	1
Mosquitolocation not on record	1
Ugentlocation not on record	1
RKlocation not on record	1

25 institutions · 2 706 of 2 734 vouchered records shown · 21 without an institution code

09Environmental DNA129 detections

Where the DNA of Aedes sticticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found129

Studies independent surveys4

Countries15

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 129 detections have coordinates

Open the map15 countries0

Mixed livestock farmdeciduousForestwoodyWetlands

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 8.30–19.5

Seasonal swing summer↔winter18.8 °C

Max temp (day)16.5 °C 11.9–23.7

Min temp (night)6.80 °C 4.60–14.2

Precipitation60.5 mm/mo 56.0–108

Air humidity60.5 % 56.6–64.0

Moisture balance-20.4 mm/mo -56.8–-1.40

Vapour deficit609 Pa 449–962

Wind speed3.20 m/s 2.30–3.90

Cloud cover41.9 % 36.8–44.9

CHELSA 1981–2010, ~9 km grid, at location & month of 70 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aedes sticticus

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type9 758 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 758 records