Adela caeruleella

Walker, 1863 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Adelidae/Adela

At a glance

Occurrence records672

Data sources7

Biological traits0

DNA specimens31

eDNA detections31

Sources7 archives

Databases and archives Adela caeruleella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility672 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF672 records

Environmental DNA1 datasets · 1 countries31 detections

DNA & barcodingBOLD31 specimens

01Narrative

Adela caeruleella, the southern longhorn moth, is a moth of the family Adelidae or fairy longhorn moths. It was described by Francis Walker in 1863. It is found in North America, including Alabama, Arkansas, Florida, Illinois, Kentucky, Louisiana, Maryland, Mississippi, North Carolina, Ohio, Oklahoma, Pennsylvania, South Carolina, Tennessee, Texas, Virginia and West Virginia.Moth Photographers Group. Mississippi State University. Adults have been recorded on wing in March in Florida, from April to May northward and in August in Quebec.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adela caeruleella has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes1

eDNA detections31

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

529Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCAGGATTACTAGGAACTTCATTAAGTTTATTAATTCGAACAGAATTAGGAATACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.09%

Haplotypes7

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adela australissame genus4.9%Adela paludicolellasame genus6.2%Adela ridingsellasame genus6.2%Adela cuprellasame genus6.7%Adela purpureasame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type672 records

Wild obs. + sensor508

Museum / vouchered164

Range

Area of Occupancy AOO1 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 189≤1 km 95≤10 km 27>10 km 63

374 georeferenced · 134 without coordinates

Open the mapobservation + sensor508

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤1 km 3≤10 km 23>10 km 2

28 georeferenced · 136 without coordinates

Open the institutions mapphysical evidence164

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	116
East Lansing, US	8
Washington, US	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Cambridge, US	2
OSUClocation not on record	2
CUlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
St. Paul, US	1

9 institutions · 138 of 164 vouchered records shown · 26 without an institution code

09Environmental DNA31 detections

Where the DNA of Adela caeruleella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 16.8–16.8

Seasonal swing summer↔winter20.6 °C

Max temp (day)22.1 °C

Min temp (night)11.5 °C

Precipitation116 mm/mo

Air humidity58.3 %

Moisture balance-21.8 mm/mo -21.8–-19.6

Vapour deficit797 Pa

Wind speed2.50 m/s

Cloud cover39.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)