Adela cuprella

Thunberg, 1794 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Adelidae/Adela

At a glance

Occurrence records1 321

Data sources9

Biological traits0

DNA specimens15

eDNA detections15

Sources9 archives

Databases and archives Adela cuprella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 321 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 321 records

Environmental DNA1 datasets · 7 countries15 detections

DNA & barcodingBOLD15 specimens

Genome at a glanceGoaT · NCBI≈680 Mbp

01Narrative

Adela cuprella is a moth of the family Adelidae and are found in most of Europe. It was first described by Michael Denis & Ignaz Schiffermüller in 1775 and the type locality is from Austria. They can be found flying around sallows (Salix) species during the day in April and May.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adela cuprella has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections15

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

316Amostly conserved

346Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCAGGATTATTGGGAACTTCCTTAAGATTATTAATTCGAACAGAATTAGGAATACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.04%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adela albicinctellasame genus2.4%Adela purpureasame genus4.3%Adela australissame genus5.3%Adela mazzolellasame genus5.5%Adela caeruleellasame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Adela cuprella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈680 072 665 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Adela cuprella0.68 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness93.7% BUSCO

08Occurrence & distribution

Record type1 321 records

Wild obs. + sensor1 237

Museum / vouchered84

Range

Area of Occupancy AOO2 968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 343≤1 km 245≤10 km 586>10 km 3

1 177 georeferenced · 60 without coordinates

Open the mapobservation + sensor1 237

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 24≤1 km 24≤10 km 27

75 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	61
SLU Artdatabankenlocation not on record	10
ZSMlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Cornell University Insect Collectionlocation not on record	1

5 institutions · 74 of 84 vouchered records shown · 10 without an institution code

09Environmental DNA15 detections

Where the DNA of Adela cuprella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.40 °C 4.20–9.60

Seasonal swing summer↔winter19.2 °C

Max temp (day)10.2 °C 7.70–13.9

Min temp (night)2.40 °C -1.60–4.40

Precipitation54.9 mm/mo 44.5–156

Air humidity59.5 % 56.4–63.0

Moisture balance-12.3 mm/mo -38.8–89.1

Vapour deficit408 Pa 315–513

Wind speed2.80 m/s 2.20–3.90

Cloud cover44.1 % 37.4–50.7

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adela cuprella

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 321 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 321 records