Adela australis

Herrich-Schäffer, 1855 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Adelidae/Adela

At a glance

Occurrence records3 141

Data sources7

Biological traits0

DNA specimens6

eDNA detections9

Sources7 archives

Databases and archives Adela australis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 141 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 141 records

Environmental DNA1 datasets · 3 countries9 detections

DNA & barcodingBOLD6 specimens

01Narrative

Adela australis is a moth of the family Adelidae or fairy longhorn moths.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adela australis has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections9

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.50%

Haplotypes2

BIN1

Most divergent pair0.76%

Where individuals differ — all 8 variable positions, in barcode order

92Amostly conserved

263Amostly conserved

266Gvariable

320Tmostly conserved

512Gvariable

614Cmostly conserved

632Tmostly conserved

644Tmostly conserved

CATTATATTTTATTTTTGGAATTTGATCAGGATTATTGGGAACTTCATTAAGTTTATTAATTCGAACAGAATTAGGAATACCTGGATCTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adela caeruleellasame genus4.9%Adela cuprellasame genus5.3%Adela purpureasame genus5.6%Adela mazzolellasame genus5.7%Adela ridingsellasame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 141 records

Wild obs. + sensor3 126

Museum / vouchered15

Range

Area of Occupancy AOO7 420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 1 428≤1 km 380≤10 km 315>10 km 75

2 198 georeferenced · 928 without coordinates

Open the mapobservation + sensor3 126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 13

14 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
European Distributed Institute of Taxonomy (EDIT)location not on record	14

1 institutions · 14 of 15 vouchered records shown · 1 without an institution code

09Environmental DNA9 detections

Where the DNA of Adela australis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

Rivuline vegetation34City parks and large gardens

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 12.8–16.6

Seasonal swing summer↔winter17.2 °C

Max temp (day)17.2 °C 16.5–20.2

Min temp (night)7.90 °C 7.30–11.1

Precipitation97.5 mm/mo 66.5–143

Air humidity56.4 % 56.0–61.0

Moisture balance-31.3 mm/mo -52.2–23.8

Vapour deficit658 Pa 581–842

Wind speed3.40 m/s 2.00–4.00

Cloud cover41.8 % 41.1–42.3

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adela australis

At a glance

Sources7 archives

At a glance

Record type3 141 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 141 records