Adela paludicolella

Zeller, 1850 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Adelidae/Adela

At a glance

Occurrence records37

Data sources7

Biological traits0

DNA specimens11

eDNA detections1

Sources7 archives

Databases and archives Adela paludicolella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF37 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD11 specimens

01Narrative

Adela paludicolella is a moth of the family Adelidae. It is found in Italy, Greece and on Corsica, Sardinia, Crete and Cyprus.Fauna Europaea

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adela paludicolella has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

22Amostly conserved

40Gmostly conserved

82Gmostly conserved

205Tmostly conserved

226Tvariable

241Tmostly conserved

271Tmostly conserved

287Tmostly conserved

298Cmostly conserved

343Tmostly conserved

346Gvariable

347Cmostly conserved

433Gvariable

578Tmostly conserved

631Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCTGGATTAGTGGGAACTTCACTAAGTTTATTAATTCGAACAGAATTAGGAATGCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.66%

Haplotypes7

BIN1

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adela caeruleellasame genus6.2%Adela ridingsellasame genus6.2%Cauchas leucocerellasame family6.2%Cauchas albiantennellasame family6.2%Adela mazzolellasame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type37 records

Wild obs. + sensor32

Museum / vouchered5

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 12≤1 km 14>10 km 1

27 georeferenced · 5 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Tiroler Landesmuseum Ferdinandeumlocation not on record	1
Royal British Columbia Museumlocation not on record	1
Cornell University Insect Collectionlocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1
Mykotektet, National Veterinary Institutelocation not on record	1

5 institutions · 5 of 5 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Adela paludicolella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 13.9–13.9

Seasonal swing summer↔winter15.7 °C

Max temp (day)17.2 °C

Min temp (night)10.0 °C

Precipitation26.7 mm/mo

Air humidity49.7 %

Moisture balance-114 mm/mo

Vapour deficit800 Pa

Wind speed2.30 m/s

Cloud cover38.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)