Acupalpus testaceus

Dejean, 1829 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Acupalpus

At a glance

Occurrence records575

Data sources7

Biological traits0

DNA specimens24

eDNA detections23

Sources7 archives

Databases and archives Acupalpus testaceus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility575 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF575 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD24 specimens

01Narrative

Acupalpus testaceus is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acupalpus testaceus has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes1

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

82Tmostly conserved

166Gmostly conserved

190Gvariable

271Tvariable

313Cmostly conserved

415Gmostly conserved

496Gvariable

622Amostly conserved

AACATTATATTTTATTTTTGGTGTGTGAGCAGGTATAGTAGGAACTTCTCTAAGTATATTAATTCGAGCAGAGTTAGGAACTCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes11

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acupalpus indistinctussame genus3.6%Acupalpus pauperculussame genus4.0%Acupalpus partiariussame genus4.1%Acupalpus hydropicussame genus6.7%Acupalpus eleganssame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type575 records

Wild obs. + sensor278

Museum / vouchered297

Range

Area of Occupancy AOO956 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 134≤1 km 52≤10 km 4>10 km 41

231 georeferenced · 47 without coordinates

Open the mapobservation + sensor278

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 28≤1 km 9≤10 km 13>10 km 10

60 georeferenced · 237 without coordinates

Open the institutions mapphysical evidence297

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	113
College Station, US	43
OSUClocation not on record	42
Tempe, US	34
Lexington, US	16
Royal Saskatchewan Museumlocation not on record	13
CUlocation not on record	9
Provo, US	6
Colorado State Universitylocation not on record	6
University Park, US	4
Lubbock, US	2
ASUlocation not on record	2
NEON Biorepository at Arizona State Universitylocation not on record	1
Carnegie Museum of Natural Historylocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
UDlocation not on record	1
EWIClocation not on record	1
Champaign, US	1

18 institutions · 296 of 297 vouchered records shown · 1 without an institution code

09Environmental DNA23 detections

Where the DNA of Acupalpus testaceus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

grasslandHerbaceouscultivatedCropspastureHaymixedForestSandy beachdeciduousForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 18.0–27.9

Seasonal swing summer↔winter21.8 °C

Max temp (day)30.2 °C 23.6–32.9

Min temp (night)21.2 °C 13.6–23.9

Precipitation118 mm/mo 67.6–151

Air humidity57.9 % 54.1–60.7

Moisture balance-49.9 mm/mo -122–13.5

Vapour deficit1,318 Pa 901–1,674

Wind speed2.60 m/s 1.50–4.80

Cloud cover31.9 % 27.3–38.7

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)