Acupalpus hydropicus

(LeConte, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Acupalpus

At a glance

Occurrence records36

Data sources7

Biological traits0

DNA specimens4

eDNA detections3

Sources7 archives

Databases and archives Acupalpus hydropicus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility36 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF36 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD4 specimens

01Narrative

Acupalpus hydropicus is an insect-eating ground beetle of the Acupalpus genus.More details, including a picture, are available on the Bug Guide website, which is here

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acupalpus hydropicus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

637Tvariable

TACATTATATTTTATTTTTGGAGTATGAGCAGGTATAATTGGAACTTCTTTAAGAATACTAATTCGAGCTGAATTAGGAACTCCTGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acupalpus nanellussame genus2.9%Acupalpus pumilussame genus3.6%Acupalpus canadensissame genus4.6%Acupalpus carussame genus5.0%Acupalpus maculatussame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type36 records

Wild obs. + sensor2

Museum / vouchered34

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 5≤1 km 3≤10 km 9

17 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University Park, US	13
Tempe, US	5
Cambridge, US	4
Provo, US	2
North Carolina State University Insect Museumlocation not on record	2
Champaign, US	2
OSUClocation not on record	1
EWIClocation not on record	1
UDlocation not on record	1

9 institutions · 31 of 34 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Acupalpus hydropicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

deciduousForestmixedForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 15.3–21.7

Seasonal swing summer↔winter26.7 °C

Max temp (day)24.4 °C 20.3–26.6

Min temp (night)14.4 °C 10.0–16.8

Precipitation108 mm/mo 104–108

Air humidity57.5 % 57.5–58.1

Moisture balance-33.9 mm/mo -45.8–-21.5

Vapour deficit945 Pa 745–1,105

Wind speed3.00 m/s 2.90–3.10

Cloud cover39.7 % 37.7–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)