Acupalpus maculatus

(Schaum, 1860) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Acupalpus

At a glance

Occurrence records732

Data sources4

Biological traits2

DNA specimens15

eDNA detections16

Sources4 archives

Databases and archives Acupalpus maculatus's data was compiled from.

GBIFGlobal Biodiversity Information Facility732 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF732 records

Environmental DNA1 datasets · 6 countries16 detections

DNA & barcodingBOLD15 specimens

Genome at a glanceGoaTdiploid

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acupalpus maculatus has left across the world's sequence archives.

At a glance

DNA specimens15

BINs2

Marker genes1

eDNA detections16

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Diversity (π)1.7%

Haplotypes2

BINs2

Most divergent pair0.30%

Where individuals differ — all 64 variable positions, in barcode order

82Tmostly conserved

100Tmostly conserved

114Amostly conserved

122Amostly conserved

124Tmostly conserved

130Tmostly conserved

139Amostly conserved

143Gmostly conserved

157Tmostly conserved

163Amostly conserved

184Amostly conserved

206Tmostly conserved

208Amostly conserved

232Cmostly conserved

238Tmostly conserved

256Tmostly conserved

266Cmostly conserved

268Tmostly conserved

286Tmostly conserved

295Amostly conserved

302Tmostly conserved

312Gvariable

313Tmostly conserved

325Tmostly conserved

340Tmostly conserved

347Tmostly conserved

349Amostly conserved

353Tmostly conserved

354Cmostly conserved

357Gmostly conserved

358Tmostly conserved

364Amostly conserved

370Tmostly conserved

379Amostly conserved

391Amostly conserved

401Tmostly conserved

403Amostly conserved

412Tmostly conserved

416Gmostly conserved

418Amostly conserved

421Amostly conserved

433Tmostly conserved

451Amostly conserved

454Tmostly conserved

457Tmostly conserved

470Tmostly conserved

484Tmostly conserved

485Tmostly conserved

488Gmostly conserved

489Amostly conserved

490Amostly conserved

492Gmostly conserved

508Tmostly conserved

514Amostly conserved

520Amostly conserved

530Tmostly conserved

532Amostly conserved

547Amostly conserved

556Amostly conserved

562Tmostly conserved

596Tmostly conserved

598Amostly conserved

604Amostly conserved

646Tvariable

AACATTATATTTTATTTTTGGAGTATGAGCAGGTATAGTAGGAACTTCTTTAAGAATATTAATTCGAGCTGAATTAGGAACTCCTGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acupalpus eleganssame genus3.3%Acupalpus parvulussame genus4.0%Acupalpus nanellussame genus5.5%Acupalpus brunnipessame genus5.6%Acupalpus pumilussame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Acupalpus maculatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidy2× diploid · measured

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type732 records

Wild obs. + sensor379

Museum / vouchered326

Fossil1

Other26

Origin

Native147

Range

Area of Occupancy AOO1 044 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 90≤1 km 36≤10 km 186>10 km 3

315 georeferenced · 64 without coordinates

Open the mapobservation + sensor379

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 2≤1 km 78≤10 km 219>10 km 5

304 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence326

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vitoria, ES	62
Geneva, CH	22
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	14
Natural History Museum Rotterdamlocation not on record	11
Provincia di Livornolocation not on record	10
Bern, CH	7
Musee d'Histoire Naturallelocation not on record	6
ZSMlocation not on record	6
Naturmuseum St. Gallenlocation not on record	6
Helsinki, FI	5
Zürich, CH	2
Forschungsinstitut für biologischen Landbau Frick \| Research Institute of Organic Agriculture Fricklocation not on record	2
NTNU-VMlocation not on record	2
Naturmuseum Solothurnlocation not on record	2
Natural History Museum, Londonlocation not on record	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
South Kensington, GB	2

17 institutions · 163 of 326 vouchered records shown · 163 without an institution code

09Environmental DNA16 detections

Where the DNA of Acupalpus maculatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map6 countries0

Marais sous tamarix

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 16.0–20.7

Seasonal swing summer↔winter19.2 °C

Max temp (day)22.4 °C 20.1–25.0

Min temp (night)12.7 °C 11.1–15.7

Precipitation77.7 mm/mo 69.2–114

Air humidity58.1 % 56.6–60.0

Moisture balance-56.1 mm/mo -80.0–8.50

Vapour deficit871 Pa 729–1,061

Wind speed3.50 m/s 1.60–4.10

Cloud cover35.6 % 33.7–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)