Acupalpus nanellus

Casey, 1914 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Acupalpus

At a glance

Occurrence records96

Data sources6

Biological traits0

DNA specimens35

eDNA detections5

Sources6 archives

Databases and archives Acupalpus nanellus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility96 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF96 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD35 specimens

01Narrative

Acupalpus nanellus is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acupalpus nanellus has left across the world's sequence archives.

At a glance

DNA specimens35

BINs2

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

7Gmostly conserved

25Amostly conserved

59Cmostly conserved

118Tmostly conserved

133Cmostly conserved

184Amostly conserved

220Tmostly conserved

235Tmostly conserved

271Cmostly conserved

286Cmostly conserved

307Gmostly conserved

340Cmostly conserved

343Tmostly conserved

355Tmostly conserved

358Amostly conserved

376Cmostly conserved

378Cmostly conserved

400Tmostly conserved

412Tmostly conserved

436Tmostly conserved

481Amostly conserved

517Amostly conserved

520Amostly conserved

548Cmostly conserved

628Gvariable

634Cmostly conserved

646Tmostly conserved

TACATTGTATTTTATTTTTGGAGTATGAGCAGGTATAATTGGAACTTCTTTAAGAATACTAATTCGAGCTGAATTAGGAACCCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes11

BINs2

Most divergent pair4.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acupalpus hydropicussame genus2.9%Acupalpus pumilussame genus3.5%Acupalpus canadensissame genus4.3%Acupalpus carussame genus4.6%Acupalpus pauperculussame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type96 records

Wild obs. + sensor2

Museum / vouchered94

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 35≤10 km 6

41 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence94

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	51
WIlocation not on record	22
Cambridge, US	6
Washington, US	2
University of Alabamalocation not on record	2
Carnegie Museum of Natural Historylocation not on record	2
NEON Biorepository at Arizona State Universitylocation not on record	1
University of Guelphlocation not on record	1
OSUClocation not on record	1

9 institutions · 88 of 94 vouchered records shown · 6 without an institution code

09Environmental DNA5 detections

Where the DNA of Acupalpus nanellus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

WetlandGrassland alvarfarm

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 15.2–21.7

Seasonal swing summer↔winter27.7 °C

Max temp (day)22.2 °C 20.6–24.8

Min temp (night)12.4 °C 10.0–19.2

Precipitation92.4 mm/mo 82.2–103

Air humidity57.2 % 56.0–58.4

Moisture balance-47.5 mm/mo -80.1–-40.2

Vapour deficit816 Pa 760–1,085

Wind speed3.40 m/s 2.70–5.20

Cloud cover42.6 % 38.1–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)